Open Access

Human Papillomavirus (HPV) genotype 18 variants in patients with clinical manifestations of HPV related infections in Bilbao, Spain

  • Sara L Arroyo1,
  • Miren Basaras1Email author,
  • Elixabete Arrese1,
  • Silvia Hernáez2,
  • Daniel Andía3,
  • Valentín Esteban2,
  • Koldo Garcia-Etxebarria4,
  • Begoña M Jugo4 and
  • Ramón Cisterna1, 2
Virology Journal20129:258

DOI: 10.1186/1743-422X-9-258

Received: 4 June 2012

Accepted: 30 October 2012

Published: 2 November 2012

Abstract

Background

Human papillomavirus (HPV) variants differ in their biological and chemical properties, and therefore, may present differences in pathogenicity. Most authors classified variants based on the phylogenetic analysis of L1 region. Nevertheless, recombination in HPV samples is becoming a usual finding and thus, characterizing genetic variability in other regions should be essential.

Objectives

We aimed to characterize the genetic variability of HPV 18 in 5 genomic regions: E6, E7, E4, L1 and the Upstream Regulatory Region (URR), working with both single infection and multiple HPV infection samples. Furthermore, we aimed to assess the prevalence of HPV 18 variants in our region and look for possible existence of recombination as well as analyze the relationship between these variants and the type of lesion.

Methods

From 2007 to 2010, Clinical Microbiology and Infection Control Department analyzed 44 samples which were positive for HPV 18. Genetic variability was determined in PCR products and variants were assigned to European, Asian-amerindian or African lineage. Recombination and association of variants with different types of lesion was studied.

Results

Genetic analysis of the regions revealed a total of 56 nucleotide variations. European, African and Asian-amerindian variants were found in 25/44 (56.8%), 10/44 (22.7%) and 5/44 (11.4%) samples, respectively. We detected the presence of recombinant variants in 2/44 (4.5%) cases. Samples taken from high-grade squamous intraepithelial lesions (H-SIL) only presented variants with specific-african substitutions.

Conclusions

Multiple HPV infection, non-european HPV variants prevalence and existence of recombination are considered risk factors for HPV persistence and progression of intraepithelial abnormalities, and therefore, should be taken into consideration in order to help to design and optimize diagnostics protocols as well as improve epidemiologic studies.

Our study is one of the few studies in Spain which analyses the genetic variability of HPV18 and we showed the importance of characterizing more than one genomic region in order to detect recombination and classify HPV variants properly.

Keywords

Human papillomavirus infection Genotype 18 Variants Recombination Multiple infection

Background

Based on the epidemiologic classification in terms of their risk to induce cervical cancer, human papillomaviruses (HPV) can be divided into 3 groups: “high-risk” genotypes associated with a greater risk of developing cancer, “low-risk” genotypes associated with low grade cell changes or benign epithelium proliferations in the genital area, but not with cancer, and “probable high-risk” genotypes from which there is not enough data about their relationship with cervical cancer to classify them [1].

About 15 genotypes are classified as high-risk types, and two of them (16 and 18) cause over 70% of all cervical cancer cases [2, 3]. Nucleotide variability of these genotypes has been largely studied and different molecular variants were described [4, 5]. These variants differ in their biological and chemical properties [68], and therefore, may become an important risk factor in cervical cancer due to possible differences in pathogenicity.

Most authors classified variants based on the phylogenetic analysis of one genomic region nucleotide variations [9]. Nevertheless, some publications have confirmed the presence of recombination in HPV samples [10, 11]. This event may occur due to a homologous recombination or to a repeated infection of the same HPV genotype but different variant and it is more often found since coinfections with more than one HPV type are becoming a usual finding [1214]. Therefore, it should be essential to determine HPV variants analyzing different genomic regions and multiple infections.

There are very few epidemiological national studies in Spain and all of them refer to HPV 16 which is the most investigated HPV type worldwide. However, there is no previous national work related to HPV 18 nucleotide variability, which is the second most prevalent HPV genotype found in cervical cancer.

The aim of the present study was: i) to characterize the genetic variability of HPV 18 in 5 genomic regions: E6, E7, E4, L1 and the Upstream Regulatory Region (URR), working with both single infection and multiple HPV infection samples, ii) assess the prevalence of HPV 18 variants in our region and look for existence of recombination, and iii) analyze the relationship between variants and types of lesion.

Results

Samples collected

Since 2007 to 2010, a total of 1085 positive samples for HPV were received and analyzed. HPV 18 was detected in 65 samples (6%). Forty-four patients consented to have their samples analyzed and studied, so this study was based on their samples: 10 single HPV infections (22.7%) and 34 multiple HPV infections (77.3%).

We were able to amplify HPV DNA in 43/44 samples for E6 region, 41/44 for E7, 35/44 for E4, 43/44 for L1 region and 44/44 for URR region. All PCR products were sequenced and sequences from each region were submitted to GenBank.

Nucleotide variations

Variant distribution was determined through E6, E7, E4, L1 and URR sequences. Genetic analysis of the regions revealed a total of 56 nucleotide variations (Figure 1).
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-258/MediaObjects/12985_2012_Article_1881_Fig1_HTML.jpg
Figure 1

Nucleotide sequence variations among HPV isolates. Numbering refers to the first nucleotide of the HPV 18 reference genome (accession number NC001357). Each row indicates the isolate identification and the PCR nucleotide sequence alignment compared to the reference. Isolates EF202143-EF202155 are HPV 18 known variant sequences which belong to Asian-amerindian lineage, African and European lineage. Nucleotide positions where a substitution leads to a change of amino acid are highlighted in gray. In the first column, samples that are highlighted in gray correspond to single HPV infection samples, whereas not highlighted samples correspond to multiple HPV infections. Dashes indicate absence of nucleotide sequence data. Recombinant variants are indicated by an asterisk.

In the E6 gene nine nucleotide variations were detected. Six of them were specific to the African lineage: T317C (6/10 African variants), T251C (9/10), A548G, G266A and G374A (present in all African isolates) and C342T (5/10 African variants) which lead to a non-synonymous amino acid alteration His/Tyr. A non-synonymous substitution T318C (Tyr/His) was found to be specific to the European lineage (2/25 European isolates), while the synonymous substitution C549A was detected among the three different branches (35/43 sequenced E6 amplimers). In our study, C287G was observed in all HPV 18 isolates.

E7 gene genetic variability analysis revealed five nucleotides substitutions. Three nucleotide variations were specific for the African lineage: C665T (3/10 African variants), C593T (His/Tyr), C640C and T864G (Asn/Ser). All of them but C665T and T864G were present in all African variants. One synonymous substitution (C751T) was detected in both European and Asian-amerindian isolates (26/34 non-African variants).

E4 gene analysis presented most nucleotide variations (17 substitutions) and almost half of them (8/17) lead to amino acid changes. All African variants showed 4 non-synonymous substitutions (C3558A His/Gln, C3578T Ser/Leu, A3586C Ser/Arg and T3593G Ile/Ser), one synonymous variation (T3534C) and a deletion of 6 amino acids (3627–3632). European variants showed 4 specific non synonymous substitutions G3482A (Ser/Asn, 3/25 isolates), T3563A (Leu/Gln, 4/25), C3617T (Ser/Leu, 4/25) and C3630G (His/Gln, all European isolates). Two non-synonymous substitutions were also detected in two European isolates: T3492A and C3615T.

L1 gene and URR sequence analysis demonstrated the presence of substitutions C6842G and T7592C in all our isolates.

Most nucleotide variations found in our study have been already described in literature except for T318C, C665T, C3615T, C3617T, G6897A, G6993A, A7000T/C, T7001C, T7007G and T7765G. Only substitutions in positions 318 and 3617 lead to amino acid changes (Tir/His and Ser/Leu, respectively). T318C substitution was present in 2 European isolates whereas C3617T nucleotide change was not specific to any lineage and was detected in 5 samples.

HPV variants

In our study, the predominant variant found was the European (25/44 samples) followed by the African (10/44) and the Asian-amerindian variants (5/44).

Phylogenetic analysis of the all regions studied showed that European and Asian-amerindian lineages formed closely related nodes as well as a maximal nucleotide diversity between African and non-African variants (Figure 2) (Additional file 1).
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-258/MediaObjects/12985_2012_Article_1881_Fig2_HTML.jpg
Figure 2

Phylogenetic tree of the HPV 18 isolates. E6, E7, E4, L1 and URR nucleotide sequences of isolates using the Bayesian inference method implemented in MrBayes 3.1. Isolates EF202143-EF202155 are included as HPV 18 reference variant sequences which belong to Asian-amerindian lineage, African and European lineage.

Isolates which showed nucleotide diversity from the three branches (European, Asian-amerindian and African) - LSM3, LSCM, LSCE, LSMK1, LSCR, LSMH1, LSC5, LSM7 and LSCB – were analyzed for possible recombination (Table 1).
Table 1

Evidence for recombinant samples

Sample \ Gene

E6

E7

E4

L1

URR

Program inference

LSM3

Af

Af

X

X

E

No recombination detected.

LSCE

Af

Af

E

E

E

Maxchi detected recombination.

(LSCM is one of the donors)

LSMK1

AsA

E

Af

E

Af

Maxchi detected recombination.

(LSCI and LSCR1 are the donors)

LSCR

E

E

E

E

E

No recombination detected.

LSMH1

E

E

E

E

E

No recombination detected.

LSC5

E

E

E

E

E

No recombination detected.

LSM7

E

E

E

E

E

No recombination detected.

LSCB

AsA

E

E

E

E

No recombination detected.

LSCM

Af

E

Af

Af

E

No recombination detected.

Isolates analyzed for possible recombination. Phylogenetic trees were constructed for each sequenced region and isolates were classified as Asian-amerindian (AsA), European (E) or African (Af) variants. RDP, Maxchi and Chimaera were used for the detection of recombination. URR: Upstream regulatory region, X: absence of data.

Phylogenetic trees were constructed for each sequenced region from these isolates and we found that samples LSCR, LSMH1, LSC5 and LSM7 belonged to the European branch in all regions and therefore, were classified as Europeans. Isolate LSCB belonged to the European lineage in all regions but in E6 (Asian-amerindian) due to the lack of one nucleotide substitution (C549A). This sample was also classified as European.

Samples LSM3, LSCM, LSCE, LSMK1 belonged to the African branch in some regions but were classified as European in others (Table 1).

RDP [15], Maxchi [16] and Chimaera were used for the detection of recombination in these 9 samples and only 2 of them were found to be recombinant, one single (LSMK1) and one multiple HPV infection (LCE) (Table 1). LSCM and LSM3 were classified as X variants (unknown).

Variants, type of lesion and infection type

Out of 44 samples, 32 were classified by pathologists as normal (no lesion was found), 9 samples were diagnosed as L-SIL while presence of H-SIL was detected in 3 specimens.

High grade lesions only presented African variants (2/3 isolates, 66.7%) and variants that presented both African and European substitutions (1/3 isolates, 33.3%) whereas most European and Asian-amerindian variants were detected in negative cytologies (Table 2).
Table 2

Human papillomavirus 18 variants vs type of lesion

Variants \ Type of Lesion

Neg

L-SIL

H-SIL

European

71.0%

3.3%

0%

Asian-amerindian

12.9%

1.1%

0%

African

12.9%

4.4%

100%

Recombinant

3.2%

1.1%

0%

Neg: no lesion, L-SIL: low-grade squamous intrapehitelial lesion, H-SIL: high-grade squamous intraephitelial lesion.

Presence of lesions associated with non-European variants was found to be statistically significant (p = 0.01053). Nevertheless, there was not a statistically significant association between type of infections (single vs multiple) and presence of lesions (p = 0.18078).

Discussion

There are almost no epidemiologic studies about HPV 18 variants carried out in Spain and even though national HPV prevalence is low, it cannot be forgotten that this genotype together with genotype 16 cause 70% of cervical cancer cases.

Many authors confirm that distribution of HPV variants is related to geographic or race distribution [6, 17] and therefore, Spain should expect predominance of European variant, followed by African and Asian-amerindian variants. Our results show concordance with this stating: 25 European variants (56.8%), 10 African (22.7%) and 5 Asian-amerindian variants (11.4%).

HPV 18 has been associated with both recurrent lesions with very bad clinical prognosis [18] and benign lesions [19]. This fact may reflect the oncogenic potential difference among variants. Hecht et al [20] identified a HPV 18 variant with lower oncogenic potential due to its absence in cervical cancer but presence in 40% of intraepithelial lesions. Villa et al [21] suggested that non-European HPV 18 variants persisted more frequently and were more associated with pre-invasive lesions. Since then, most studies confirm that different variants of the same genotype differ in their pathogenic characteristics and therefore, nucleotide substitutions may play an important role. Our study results show concordance with these statements as African variants and variants where most of specific-african substitutions were detected were the only type of variants detected in H-SIL.

Most nucleotide changes reported in our study have been previously described and some of them are of particular importance. In URR, the mutation A41G is located in the Sp-1 binding site and isolates with this nucleotide variation have shown to have an increased transcriptional activity [22]. Variations in positions 41 and 104 modulate Sp1 and YY1 activities and are associated to a higher activity of the E6/E7 promoter. Patients with T104C substitution are less likely to present tumour recurrence [23]. Other nucleotide changes like T7651C, A7658C and C7726T also lay within transcription factor binding sites.

Substitutions C287G, C6842G and T7592C were found in all our isolates. Variation C6842G has been previously reported as error in the original sequence [24], and H. Arias–Pulido et al. sequenced the original reference HPV 18 plasmid (provided by E-M de Villiers, Deutsches Krebsforschungzentrum, Germany) and observed the substitution T7592C [25], so it is considered as a sequencing error in the original HPV 18 reference sequence report.

Furthermore, ten “new” nucleotide variations have been detected and two of them were non-synonymous and lead to amino acid changes (T318C and C3617T, Tir/His and Ser/Leu, respectively).

Knowledge on HPV variants and their nucleotide variability is essential for three main reasons: i) nucleotide variations may interfere with the viral oncogenic potential, ii) host cellular immune response can be different when there are substitutions in the amino acids on the viral capsid which may be relevant for the vaccination, iii) HPV infections with a variant may not give immunological protection against a subsequent infection with other variant of the same genotype.

Nowadays, HPV variants recombination has already been described and it is more often found since coinfection with more than one HPV type prevalence is not a unusual finding [10].

In our study we detected 2 recombinant variants (4.5%) which might have been missed or wrong classified if only amplifying one genomic region. Furthermore, non-recombinant samples as LSCM or LSM3 showed specific-african substitutions in some regions (for example E6) whereas they would be classified as european variants when only analyzing nucleotide variation in URR. Therefore, characterizing more than one genomic region may be essential in order to detect recombination and classify HPV variants properly.

We amplified URR and E6, E7 and L1genes from at least 93% of samples. However, when characterizing E4 region, we were only able to amplify 35 samples. E4 gene is generally disrupted during DNA integration into the host genome and this disruption may explain the inability to amplify E4 gene in some of our samples.

In conclusion, data and knowledge on geographic HPV intratypic variants distribution might help to establish a data base about the diversity and pathogenicity of different HPV variants, which may help to design and optimize diagnostics protocols in order to reduce the disease.

Methods

Recruitment of participants

Clinical Microbiology and Infection Control Department at Basurto University Hospital (Basque Country, North of Spain) analyzed samples which were remitted from different Hospital Services, especially the Consultation of Sexually Transmitted Diseases and the Department of Obstetrics and Gynecology, from 2007 to 2010.

All samples were collected from patients with clinical manifestations of HPV related infections. Lesions were classified by pathologists into three categories: negative (no lesion was found), low-grade squamous intraepithelial lesion (L-SIL) or high-grade squamous intraepithelial lesion (H-SIL).

Molecular genotyping was carried out using “Linear Array HPV Genotyping Test” kit (Roche Molecular Diagnostics). In our study, we analyzed positive samples for HPV genotype 18 (both single infections and multiple HPV infections) from patients who had given written, informed consent.

Genomic DNA extraction

DNA extraction was performed by QIAamp DNA mini Kit (Qiagen, Hilden, Germany), according to the manufacturer´s instructions. Extracted DNA was eluted with 200 μl AE buffer and stored at −20°C until amplification.

PCR amplification and sequencing

Amplification of HPV E6, E7, E4 genes and the URR was performed using type-specific primers designed according to HPV 18 genome prototype sequence (GenBank accession number NC001357). The URR was amplified using 2 primer sets. In order to amplify L1 region, consensus HPV primers were used (Table 3).
Table 3

Polymerase chain reaction characteristics for Human papillomavirus 18

 

Primer sequence (5′ – 3′)

Annealing Temp/Cycles

Nucleotides amplified*

Amplicon size

E6 F

AGTAACCGAAAACGGTCGGGA

55°C/40 cycles

38-491

454 pb

E6 R

GTTGTGAAATCGTCGTTTTTCA

   

E7 F

TGAAAAACGACGATTTCACAAC

55°C/40 cycles

470-931

462 pb

E7 R

ACCTTCTGGATCAGCCATTG

   

E4 F

GTAAAGGAAGGGTACAACACG

57°C/35 cycles

3309-3792

484 pb

E4 R

CTGTCCAATGCCAGGTGGA

   

LCR 1 F

TCGGTTGCCTTTGGCTTAT

55°C/40 cycles

7465-7775

311 pb

LCR 1 R

AAGGGTAGACAGAATGTTGGACA

55°C/40 cycles

7718-163

303 pb

LCR 2 F

GCTAATTGCATACTTGGCTTG

   

LCR 2 R

TCCGTGCACAGATCAGGTAG

   

MY11

GCACAGGGTCATAACAATGG

55°C/40 cycles

6558-7012

455 pb

MY09

CGTCCAAGGGATATTGATC

   

L1 seq

ACAGTCTCCTGTACCTGGG

   

*Position numbering refers to the first nucleotide of the HPV 18 reference genome (accession number NC001357). F: forward primer, R: reverse primer.

PCR was performed in 30 μl of reaction mixture containing 10 × PCR buffer, 25 mmol/L MgCl2, 25 mmol/L of each deoxynucleoside, 100 pmol/L of sense and anti-sense primer, 5 μl of template DNA and 2,5 U of Taq DNA polymerase (Qiagen).

The thermal program started with a pre-heat of 95°C for 15 min, followed by 35–40 cycles of suitable annealing temperature which depended on the primers and finished with a final extension at 72°C for 10 min (Table 3).

PCR products were confirmed based on specific bands of amplified DNA presence in agarose gel (2%). Afterwards, amplimers were automatically sequenced using the “Big Dye Terminator Cycle Sequencing kit” (Applied Biosystems) according to the manufacturer´s instructions.

For E6, E7, E4 and URR amplicons the same forward specific primers as those used in amplification were chosen as sequencing primers. In the L1 region, a specific primer was used in order to sequence HPV 18 and not other HPV types present in cases of multiple infection (Table 3).

Nucleotide variations, phylogenetic analysis: variants and recombination

HPV sequences were aligned and compared to the HPV 18 prototype sequence which belongs to the Asian-amerindian lineage (accession number NC001357), using BioEdit Sequence Alignment Editor v7.0.4.1 and Clustal W (http://​www.​genome.​jp/​tools/​clustalw/​).

Amplification and sequencing of the samples were repeated to confirm nucleotide variations which were present in less than three isolates.

Sequences were assigned to a lineage on the basis of their similarity to HPV 18 known variant sequences [26] which belong to Asian-amerindian lineage (GenBank accession numbers: EF202143 - EF202146), African (EF202152 - EF202155) and European lineage (EF202147- EF202149, EF202151). Phylogenetic trees were built using the Bayesian inference method implemented in MrBayes 3.1 [27] and three methods (all implemented in RDP3 [15]) were used for the detection of recombination (RDP [15], Maxchi [16] and Chimaera) to analyze isolates which did not adjust to the clusters.

Lesions

Association of lesions and variants or infection type (single HPV vs multiple HPV infection) was analyzed. Fisher exact test was used for statistically significant association.

GenBank accession numbers

The following are the GenBank accession numbers for all the sequences used in this analysis. X indicates absence of nucleotide sequence data Table 4.
Table 4

GeneBank accession numbers for the sequenced isolates

Isolate

E6

E7

E4

L1

URR

LSM1

JN416211

JN416162

X

JN416262

JN416313

LSM2

JN416212

JN416163

JN416121

JN416263

JN416314

LSM3

JN416213

JN416164

X

X

JN416315

LSM4

JN416214

JN416165

JN416122

JN416264

JN416316

LSC5

JN416215

JN416166

JN416123

JN416265

JN416317

LSM6

JN416216

X

X

JN416266

JN416318

LSM7

JN416217

JN416167

JN416124

JN416267

JN416319

LSC9

JN416219

JN416169

JN416125

JN416269

JN416321

LSCA

JN416220

JN416170

X

JN416270

JN416322

LSCB

JN416221

JN416171

JN416126

JN416271

JN416323

LSCC

JN416222

JN416172

JN416127

JN416272

JN416324

LSCD

JN416223

JN416173

X

JN416273

JN416325

LSCE

JN416224

JN416174

JN416128

JN416274

JN416326

LSCF

X

X

X

JN416275

JN416327

LSCG

JN416225

JN416175

X

JN416276

JN416328

LSCH

JN416226

JN416176

JN416129

JN416277

JN416329

LSCI

JN416227

JN416177

JN416130

JN416278

JN416330

LSCJ

JN416228

JN416178

JN416131

JN416279

JN416331

LSCK

JN416229

JN416179

JN416132

JN416280

JN416332

LSCL

JN416230

JN416180

JN416133

JN416281

JN416333

LSCM

JN416231

JN416181

JN416134

JN416282

JN416334

LSCP

JN416232

JN416182

JN416135

JN416283

JN416335

LSCR

JN416234

JN416184

JN416137

JN416285

JN416337

LSCS

JN416235

X

JN416138

JN416286

JN416338

LSCW

JN416238

JN416187

JN416141

JN416289

JN416341

LSCX

JN416239

JN416188

JN416142

JN416290

JN416342

LSCY

JN416240

JN416189

JN416143

JN416291

JN416343

LSCA1

JN416241

JN416190

JN416144

JN416292

JN416344

LSCC1

JN416243

JN416192

JN416146

JN416294

JN416346

LSCE1

JN416245

JN416194

X

JN416296

JN416348

LSMF1

JN416246

JN416195

JN416147

JN416297

JN416349

LSMG1

JN416247

JN416196

JN416148

JN416298

JN416350

LSCH1

JN416248

JN416197

JN416149

JN416299

JN416351

LSCI1

JN416249

JN416198

JN416150

JN416300

JN416352

LSCJ1

JN416250

JN416199

JN416151

JN416301

JN416353

LSMK1

JN416251

JN416200

JN416152

JN416302

JN416354

LSML1

JN416252

JN416201

JN416153

JN416303

JN416355

LSCM1

JN416253

JN416202

JN416154

JN416304

JN416356

LSCP1

JN416256

JN416205

JN416157

JN416307

JN416359

LSCQ1

JN416257

JN416206

JN416158

JN416308

JN416360

LSCR1

JN416258

JN416207

JN416159

JN416309

JN416361

LSCS1

JN416259

JN416208

JN416160

JN416310

JN416362

LSCT1

JN416260

JN416209

X

JN416311

JN416363

LSCU1

JN416261

JN416210

JN416161

JN416312

JN416364

Ethical approval

All procedures followed were approved by the appropriate Ethics Commitee related to our institutions (Basurto University Hospital and University of Basque Country) and complied with the guidelines and ethical standards for experimental investigation with human subjects of Helsinki Declaration of 1975, as revised in 2000. All study participants provided written, informed consent.

Abbreviations

HPV: 

Human papillomavirus

H-SIL: 

High-grade squamous intraepithelial lesion

L-SIL: 

Low-grade squamous intraepithelial lesion

SIL: 

Squamous intraepithelial lesion

URR: 

Upstream regulatory region.

Declarations

Acknowledgements

Authors wish to thank the Department of Health from the Basque Government for supporting this project [project number 2008111058].

Authors’ Affiliations

(1)
Immunology, Microbiology and Parasitology Department, University of Basque Country
(2)
Clinical Microbiology and Infection Control Department, Basurto University Hospital
(3)
Obstetrics and Gynecology Department, Basurto University Hospital
(4)
Genetics, Physical Anthropology and Animal Physiology Department, University of Basque Country

References

  1. Muñoz N, Castellsague X, de Gonzalez AB, Gissmann L: HPV in the etiology of human cancer. Vaccine. 2006, 24: 1-10. 10.1016/j.vaccine.2005.07.047.View Article
  2. Smith JS, Lindsay L, Hoots B, Keys J, Franceschi S, Winer R, et al: Human papillomavirus type distribution in invasive cervical cancer and high-grade cervical lesions: a meta-analysis update. Int J Cancer. 2007, 121: 621-632. 10.1002/ijc.22527.PubMedView Article
  3. Muñoz N, Bosch FX, Castellsagué X, Díaz M, de Sanjose S, Hammouda D, et al: Against which human papillomavirus types shall we vaccinate and screen? the international perspective. Int J Cancer. 2004, 111: 278-285. 10.1002/ijc.20244.PubMedView Article
  4. Yamada T, Manos MM, Peto J, Greer CE, Munoz N, Bosch FX, et al: Human papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J Virol. 1997, 71: 2463-2472.PubMedPubMed Central
  5. Ong CK, Chan SY, Campo MS, Campo MS, Fujinaga K, Mavromara-Nazos P, et al: Evolution of human papillomavirus type 18: an ancient phylogenetic root in Africa and intratype diversity reflect coevolution with human ethnic groups. J Virol. 1993, 67: 6424-6431.PubMedPubMed Central
  6. de Araujo Souza PS, Sichero L, Macia PC: HPV variants and HLA polymorphisms: the role of variability on the risk of cervical cancer. Future Oncol. 2009, 5: 359-370. 10.2217/fon.09.8.PubMedView Article
  7. Sichero L, Ferreira S, Trottier H, Duarte-Franco E, Ferenczy A, Franco EL, et al: High grade cervical lesions are caused preferentially by non-european variants of HPVs 16 and 18. Int J Cancer. 2007, 120: 1763-1768. 10.1002/ijc.22481.PubMedView Article
  8. López-Savedra A, González-Maya L, de Ponce León S, García-Carranca A, Mohar A, Lizano M: Functional implication of sequence variation in the long control region and E2 gene among human papillomavirus type 18 variants. Arch Virol. 2009, 154: 747-754. 10.1007/s00705-009-0362-4.View Article
  9. de Villiers EM, Fauquet C, Broker TR, Bernard HU, Zur HH: Classification of papillomaviruses. Virology. 2004, 324: 17-27. 10.1016/j.virol.2004.03.033.PubMedView Article
  10. Angulo M, Carvajal-Rodríguez A: Evidence of recombination within human alpha-papillomavirus. Virol J. 2007, 4: 33-10.1186/1743-422X-4-33.PubMedPubMed CentralView Article
  11. Jiang M, Xi LF, Edelstein ZR, Galloway DA, Olsem GJ, Lin WC, et al: Identification of recombinant human papillomavirus type 16 variants. Virology. 2009, 394: 8-11. 10.1016/j.virol.2009.08.040.PubMedPubMed CentralView Article
  12. Méndez F, Muñoz N, Posso H, Molano M, Moreno V, van den Brule AJ, et al: Cervical coinfection with human papillomavirus (HPV) types and possible implications for the prevention of cervical cancer by HPV vaccines. J Infect Dis. 2005, 192: 1158-1165. 10.1086/444391.PubMedView Article
  13. Tinelli A, Leo G, Dell’Edera D, Storelli F, Galante MM, Guido M, et al: Molecular methods for a correct diagnosis of multiple HPV infections and clinical implications for vaccine. Int J Gynecol Cancer. 2011, 21: 545-550. 10.1097/IGC.0b013e31820f5eed.PubMedView Article
  14. Nielson CM, Harris RB, Flores R, Abrahamsen M, Papenfuss MR, Dunne EF, et al: Multiple-type human papillomavirus infection in male anogenital sites: prevalence and associated factors. Cancer Epidemiol Biomarkers Prev. 2009, 18: 1077-1083. 10.1158/1055-9965.EPI-08-0447.PubMedView Article
  15. Martin DP, Lemey P, Lott M, Moulton V, Posada D, Lefeuvre P: RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics. 2010, 26: 2462-2463. 10.1093/bioinformatics/btq467.PubMedPubMed CentralView Article
  16. Smith J: Analyzing the mosaic structure of genes. J Mol Evol. 1992, 34: 126-129.PubMed
  17. Xi LF, Kiviat NB, Hildesheim A, Galloway DA, Wheeler CM, Ho J, et al: Human papillomavirus type 16 and 18 variants: race-related distribution and persistence. J Natl Cancer Inst. 2006, 98: 1045-1052. 10.1093/jnci/djj297.PubMedView Article
  18. Im SS, Wilczynski SP, Burge RA, Monk BJ: Early stage cervical cancers containing human papillomavirus type 18 DNA have more nodal metastasis and deeper stromal invasion. Clin Cancer Res. 2003, 9: 4145-4150.PubMed
  19. Burger R, Monk BJ, Kurosaki T, Anton-Culver H, Vasiley SA, Berman ML, et al: Human papillomavirus type 18: association with poor prognosis in early stage cancer. J Natl Cancer Inst. 1996, 88: 1361-1368. 10.1093/jnci/88.19.1361.PubMedView Article
  20. Hecht J, Kadish A, Jiang G, Burk R: Genetic characterization of the human papillomavirus (HPV) 18 E2 gene in clinical specimens suggests the presence of a subtype with decreased oncogenic potential. Int J Cancer. 1995, 60: 369-376. 10.1002/ijc.2910600317.PubMedView Article
  21. Villa LL, Sichero L, Rahal P, Caballero O, Ferenczy A, Rohan T, et al: Molecular variants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasma. J Gen Virol. 2000, 81: 2959-2968.PubMedView Article
  22. Rose B, Steger G, Dong XP, Thompson C, Cossart Y, Tattersall M, et al: Point mutations in SP1 motifs in the upstream regulatory region of human papillomavirus type 18 isolates from cervical cancers increase promoter activity. J Gen Virol. 1998, 79: 1659-1663.PubMedView Article
  23. Rose B, Thompson CH, Zhang J, Stoeter M, Stephen A, Pfister H, et al: Sequence variation in the upstream regulatory region of HPV 18 isolates from cervical cancers. Gynecol Oncol. 1997, 66: 282-289. 10.1006/gyno.1997.4740.PubMedView Article
  24. Meissner J, et al: Sequencing errors in reference HPV clones. Human papillomaviruses. A compilation and analysis of nucleic acid and amino acid sequences. Edited by: Myers G, Baker C, Munger K. 1997, Los Alamos (NM): Theoretical Biology and Biophysics, Los Alamos National Laboratory, 110-123. 3
  25. Arias-Pulido H, Peyton CL, Torrez-Martinez N, Anderson DN, Wheeler CM: Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions. Virology. 2005, 338: 22-34. 10.1016/j.virol.2005.04.022.PubMedView Article
  26. Chen Z, DeSalle R, Schiffmn M, Herrero R, Burk RD: Evolutionary dynamics of variant genomes of human papillomavirus types 18, 45 and 97. J Virol. 2009, 83: 1443-1455. 10.1128/JVI.02068-08.PubMedPubMed CentralView Article
  27. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003, 19: 1572-1574. 10.1093/bioinformatics/btg180.PubMedView Article

Copyright

© Arroyo et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement