Human Papillomavirus (HPV) genotype 18 variants in patients with clinical manifestations of HPV related infections in Bilbao, Spain

  • Sara L Arroyo1,

    Affiliated with

    • Miren Basaras1Email author,

      Affiliated with

      • Elixabete Arrese1,

        Affiliated with

        • Silvia Hernáez2,

          Affiliated with

          • Daniel Andía3,

            Affiliated with

            • Valentín Esteban2,

              Affiliated with

              • Koldo Garcia-Etxebarria4,

                Affiliated with

                • Begoña M Jugo4 and

                  Affiliated with

                  • Ramón Cisterna1, 2

                    Affiliated with

                    Virology Journal20129:258

                    DOI: 10.1186/1743-422X-9-258

                    Received: 4 June 2012

                    Accepted: 30 October 2012

                    Published: 2 November 2012

                    Abstract

                    Background

                    Human papillomavirus (HPV) variants differ in their biological and chemical properties, and therefore, may present differences in pathogenicity. Most authors classified variants based on the phylogenetic analysis of L1 region. Nevertheless, recombination in HPV samples is becoming a usual finding and thus, characterizing genetic variability in other regions should be essential.

                    Objectives

                    We aimed to characterize the genetic variability of HPV 18 in 5 genomic regions: E6, E7, E4, L1 and the Upstream Regulatory Region (URR), working with both single infection and multiple HPV infection samples. Furthermore, we aimed to assess the prevalence of HPV 18 variants in our region and look for possible existence of recombination as well as analyze the relationship between these variants and the type of lesion.

                    Methods

                    From 2007 to 2010, Clinical Microbiology and Infection Control Department analyzed 44 samples which were positive for HPV 18. Genetic variability was determined in PCR products and variants were assigned to European, Asian-amerindian or African lineage. Recombination and association of variants with different types of lesion was studied.

                    Results

                    Genetic analysis of the regions revealed a total of 56 nucleotide variations. European, African and Asian-amerindian variants were found in 25/44 (56.8%), 10/44 (22.7%) and 5/44 (11.4%) samples, respectively. We detected the presence of recombinant variants in 2/44 (4.5%) cases. Samples taken from high-grade squamous intraepithelial lesions (H-SIL) only presented variants with specific-african substitutions.

                    Conclusions

                    Multiple HPV infection, non-european HPV variants prevalence and existence of recombination are considered risk factors for HPV persistence and progression of intraepithelial abnormalities, and therefore, should be taken into consideration in order to help to design and optimize diagnostics protocols as well as improve epidemiologic studies.

                    Our study is one of the few studies in Spain which analyses the genetic variability of HPV18 and we showed the importance of characterizing more than one genomic region in order to detect recombination and classify HPV variants properly.

                    Keywords

                    Human papillomavirus infection Genotype 18 Variants Recombination Multiple infection

                    Background

                    Based on the epidemiologic classification in terms of their risk to induce cervical cancer, human papillomaviruses (HPV) can be divided into 3 groups: “high-risk” genotypes associated with a greater risk of developing cancer, “low-risk” genotypes associated with low grade cell changes or benign epithelium proliferations in the genital area, but not with cancer, and “probable high-risk” genotypes from which there is not enough data about their relationship with cervical cancer to classify them [1].

                    About 15 genotypes are classified as high-risk types, and two of them (16 and 18) cause over 70% of all cervical cancer cases [2, 3]. Nucleotide variability of these genotypes has been largely studied and different molecular variants were described [4, 5]. These variants differ in their biological and chemical properties [68], and therefore, may become an important risk factor in cervical cancer due to possible differences in pathogenicity.

                    Most authors classified variants based on the phylogenetic analysis of one genomic region nucleotide variations [9]. Nevertheless, some publications have confirmed the presence of recombination in HPV samples [10, 11]. This event may occur due to a homologous recombination or to a repeated infection of the same HPV genotype but different variant and it is more often found since coinfections with more than one HPV type are becoming a usual finding [1214]. Therefore, it should be essential to determine HPV variants analyzing different genomic regions and multiple infections.

                    There are very few epidemiological national studies in Spain and all of them refer to HPV 16 which is the most investigated HPV type worldwide. However, there is no previous national work related to HPV 18 nucleotide variability, which is the second most prevalent HPV genotype found in cervical cancer.

                    The aim of the present study was: i) to characterize the genetic variability of HPV 18 in 5 genomic regions: E6, E7, E4, L1 and the Upstream Regulatory Region (URR), working with both single infection and multiple HPV infection samples, ii) assess the prevalence of HPV 18 variants in our region and look for existence of recombination, and iii) analyze the relationship between variants and types of lesion.

                    Results

                    Samples collected

                    Since 2007 to 2010, a total of 1085 positive samples for HPV were received and analyzed. HPV 18 was detected in 65 samples (6%). Forty-four patients consented to have their samples analyzed and studied, so this study was based on their samples: 10 single HPV infections (22.7%) and 34 multiple HPV infections (77.3%).

                    We were able to amplify HPV DNA in 43/44 samples for E6 region, 41/44 for E7, 35/44 for E4, 43/44 for L1 region and 44/44 for URR region. All PCR products were sequenced and sequences from each region were submitted to GenBank.

                    Nucleotide variations

                    Variant distribution was determined through E6, E7, E4, L1 and URR sequences. Genetic analysis of the regions revealed a total of 56 nucleotide variations (Figure 1).
                    http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-258/MediaObjects/12985_2012_1881_Fig1_HTML.jpg
                    Figure 1

                    Nucleotide sequence variations among HPV isolates. Numbering refers to the first nucleotide of the HPV 18 reference genome (accession number NC001357). Each row indicates the isolate identification and the PCR nucleotide sequence alignment compared to the reference. Isolates EF202143-EF202155 are HPV 18 known variant sequences which belong to Asian-amerindian lineage, African and European lineage. Nucleotide positions where a substitution leads to a change of amino acid are highlighted in gray. In the first column, samples that are highlighted in gray correspond to single HPV infection samples, whereas not highlighted samples correspond to multiple HPV infections. Dashes indicate absence of nucleotide sequence data. Recombinant variants are indicated by an asterisk.

                    In the E6 gene nine nucleotide variations were detected. Six of them were specific to the African lineage: T317C (6/10 African variants), T251C (9/10), A548G, G266A and G374A (present in all African isolates) and C342T (5/10 African variants) which lead to a non-synonymous amino acid alteration His/Tyr. A non-synonymous substitution T318C (Tyr/His) was found to be specific to the European lineage (2/25 European isolates), while the synonymous substitution C549A was detected among the three different branches (35/43 sequenced E6 amplimers). In our study, C287G was observed in all HPV 18 isolates.

                    E7 gene genetic variability analysis revealed five nucleotides substitutions. Three nucleotide variations were specific for the African lineage: C665T (3/10 African variants), C593T (His/Tyr), C640C and T864G (Asn/Ser). All of them but C665T and T864G were present in all African variants. One synonymous substitution (C751T) was detected in both European and Asian-amerindian isolates (26/34 non-African variants).

                    E4 gene analysis presented most nucleotide variations (17 substitutions) and almost half of them (8/17) lead to amino acid changes. All African variants showed 4 non-synonymous substitutions (C3558A His/Gln, C3578T Ser/Leu, A3586C Ser/Arg and T3593G Ile/Ser), one synonymous variation (T3534C) and a deletion of 6 amino acids (3627–3632). European variants showed 4 specific non synonymous substitutions G3482A (Ser/Asn, 3/25 isolates), T3563A (Leu/Gln, 4/25), C3617T (Ser/Leu, 4/25) and C3630G (His/Gln, all European isolates). Two non-synonymous substitutions were also detected in two European isolates: T3492A and C3615T.

                    L1 gene and URR sequence analysis demonstrated the presence of substitutions C6842G and T7592C in all our isolates.

                    Most nucleotide variations found in our study have been already described in literature except for T318C, C665T, C3615T, C3617T, G6897A, G6993A, A7000T/C, T7001C, T7007G and T7765G. Only substitutions in positions 318 and 3617 lead to amino acid changes (Tir/His and Ser/Leu, respectively). T318C substitution was present in 2 European isolates whereas C3617T nucleotide change was not specific to any lineage and was detected in 5 samples.

                    HPV variants

                    In our study, the predominant variant found was the European (25/44 samples) followed by the African (10/44) and the Asian-amerindian variants (5/44).

                    Phylogenetic analysis of the all regions studied showed that European and Asian-amerindian lineages formed closely related nodes as well as a maximal nucleotide diversity between African and non-African variants (Figure 2) (Additional file 1).
                    http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-258/MediaObjects/12985_2012_1881_Fig2_HTML.jpg
                    Figure 2

                    Phylogenetic tree of the HPV 18 isolates. E6, E7, E4, L1 and URR nucleotide sequences of isolates using the Bayesian inference method implemented in MrBayes 3.1. Isolates EF202143-EF202155 are included as HPV 18 reference variant sequences which belong to Asian-amerindian lineage, African and European lineage.

                    Isolates which showed nucleotide diversity from the three branches (European, Asian-amerindian and African) - LSM3, LSCM, LSCE, LSMK1, LSCR, LSMH1, LSC5, LSM7 and LSCB – were analyzed for possible recombination (Table 1).
                    Table 1

                    Evidence for recombinant samples

                    Sample \ Gene

                    E6

                    E7

                    E4

                    L1

                    URR

                    Program inference

                    LSM3

                    Af

                    Af

                    X

                    X

                    E

                    No recombination detected.

                    LSCE

                    Af

                    Af

                    E

                    E

                    E

                    Maxchi detected recombination.

                    (LSCM is one of the donors)

                    LSMK1

                    AsA

                    E

                    Af

                    E

                    Af

                    Maxchi detected recombination.

                    (LSCI and LSCR1 are the donors)

                    LSCR

                    E

                    E

                    E

                    E

                    E

                    No recombination detected.

                    LSMH1

                    E

                    E

                    E

                    E

                    E

                    No recombination detected.

                    LSC5

                    E

                    E

                    E

                    E

                    E

                    No recombination detected.

                    LSM7

                    E

                    E

                    E

                    E

                    E

                    No recombination detected.

                    LSCB

                    AsA

                    E

                    E

                    E

                    E

                    No recombination detected.

                    LSCM

                    Af

                    E

                    Af

                    Af

                    E

                    No recombination detected.

                    Isolates analyzed for possible recombination. Phylogenetic trees were constructed for each sequenced region and isolates were classified as Asian-amerindian (AsA), European (E) or African (Af) variants. RDP, Maxchi and Chimaera were used for the detection of recombination. URR: Upstream regulatory region, X: absence of data.

                    Phylogenetic trees were constructed for each sequenced region from these isolates and we found that samples LSCR, LSMH1, LSC5 and LSM7 belonged to the European branch in all regions and therefore, were classified as Europeans. Isolate LSCB belonged to the European lineage in all regions but in E6 (Asian-amerindian) due to the lack of one nucleotide substitution (C549A). This sample was also classified as European.

                    Samples LSM3, LSCM, LSCE, LSMK1 belonged to the African branch in some regions but were classified as European in others (Table 1).

                    RDP [15], Maxchi [16] and Chimaera were used for the detection of recombination in these 9 samples and only 2 of them were found to be recombinant, one single (LSMK1) and one multiple HPV infection (LCE) (Table 1). LSCM and LSM3 were classified as X variants (unknown).

                    Variants, type of lesion and infection type

                    Out of 44 samples, 32 were classified by pathologists as normal (no lesion was found), 9 samples were diagnosed as L-SIL while presence of H-SIL was detected in 3 specimens.

                    High grade lesions only presented African variants (2/3 isolates, 66.7%) and variants that presented both African and European substitutions (1/3 isolates, 33.3%) whereas most European and Asian-amerindian variants were detected in negative cytologies (Table 2).
                    Table 2

                    Human papillomavirus 18 variants vs type of lesion

                    Variants \ Type of Lesion

                    Neg

                    L-SIL

                    H-SIL

                    European

                    71.0%

                    3.3%

                    0%

                    Asian-amerindian

                    12.9%

                    1.1%

                    0%

                    African

                    12.9%

                    4.4%

                    100%

                    Recombinant

                    3.2%

                    1.1%

                    0%

                    Neg: no lesion, L-SIL: low-grade squamous intrapehitelial lesion, H-SIL: high-grade squamous intraephitelial lesion.

                    Presence of lesions associated with non-European variants was found to be statistically significant (p = 0.01053). Nevertheless, there was not a statistically significant association between type of infections (single vs multiple) and presence of lesions (p = 0.18078).

                    Discussion

                    There are almost no epidemiologic studies about HPV 18 variants carried out in Spain and even though national HPV prevalence is low, it cannot be forgotten that this genotype together with genotype 16 cause 70% of cervical cancer cases.

                    Many authors confirm that distribution of HPV variants is related to geographic or race distribution [6, 17] and therefore, Spain should expect predominance of European variant, followed by African and Asian-amerindian variants. Our results show concordance with this stating: 25 European variants (56.8%), 10 African (22.7%) and 5 Asian-amerindian variants (11.4%).

                    HPV 18 has been associated with both recurrent lesions with very bad clinical prognosis [18] and benign lesions [19]. This fact may reflect the oncogenic potential difference among variants. Hecht et al [20] identified a HPV 18 variant with lower oncogenic potential due to its absence in cervical cancer but presence in 40% of intraepithelial lesions. Villa et al [21] suggested that non-European HPV 18 variants persisted more frequently and were more associated with pre-invasive lesions. Since then, most studies confirm that different variants of the same genotype differ in their pathogenic characteristics and therefore, nucleotide substitutions may play an important role. Our study results show concordance with these statements as African variants and variants where most of specific-african substitutions were detected were the only type of variants detected in H-SIL.

                    Most nucleotide changes reported in our study have been previously described and some of them are of particular importance. In URR, the mutation A41G is located in the Sp-1 binding site and isolates with this nucleotide variation have shown to have an increased transcriptional activity [22]. Variations in positions 41 and 104 modulate Sp1 and YY1 activities and are associated to a higher activity of the E6/E7 promoter. Patients with T104C substitution are less likely to present tumour recurrence [23]. Other nucleotide changes like T7651C, A7658C and C7726T also lay within transcription factor binding sites.

                    Substitutions C287G, C6842G and T7592C were found in all our isolates. Variation C6842G has been previously reported as error in the original sequence [24], and H. Arias–Pulido et al. sequenced the original reference HPV 18 plasmid (provided by E-M de Villiers, Deutsches Krebsforschungzentrum, Germany) and observed the substitution T7592C [25], so it is considered as a sequencing error in the original HPV 18 reference sequence report.

                    Furthermore, ten “new” nucleotide variations have been detected and two of them were non-synonymous and lead to amino acid changes (T318C and C3617T, Tir/His and Ser/Leu, respectively).

                    Knowledge on HPV variants and their nucleotide variability is essential for three main reasons: i) nucleotide variations may interfere with the viral oncogenic potential, ii) host cellular immune response can be different when there are substitutions in the amino acids on the viral capsid which may be relevant for the vaccination, iii) HPV infections with a variant may not give immunological protection against a subsequent infection with other variant of the same genotype.

                    Nowadays, HPV variants recombination has already been described and it is more often found since coinfection with more than one HPV type prevalence is not a unusual finding [10].

                    In our study we detected 2 recombinant variants (4.5%) which might have been missed or wrong classified if only amplifying one genomic region. Furthermore, non-recombinant samples as LSCM or LSM3 showed specific-african substitutions in some regions (for example E6) whereas they would be classified as european variants when only analyzing nucleotide variation in URR. Therefore, characterizing more than one genomic region may be essential in order to detect recombination and classify HPV variants properly.

                    We amplified URR and E6, E7 and L1genes from at least 93% of samples. However, when characterizing E4 region, we were only able to amplify 35 samples. E4 gene is generally disrupted during DNA integration into the host genome and this disruption may explain the inability to amplify E4 gene in some of our samples.

                    In conclusion, data and knowledge on geographic HPV intratypic variants distribution might help to establish a data base about the diversity and pathogenicity of different HPV variants, which may help to design and optimize diagnostics protocols in order to reduce the disease.

                    Methods

                    Recruitment of participants

                    Clinical Microbiology and Infection Control Department at Basurto University Hospital (Basque Country, North of Spain) analyzed samples which were remitted from different Hospital Services, especially the Consultation of Sexually Transmitted Diseases and the Department of Obstetrics and Gynecology, from 2007 to 2010.

                    All samples were collected from patients with clinical manifestations of HPV related infections. Lesions were classified by pathologists into three categories: negative (no lesion was found), low-grade squamous intraepithelial lesion (L-SIL) or high-grade squamous intraepithelial lesion (H-SIL).

                    Molecular genotyping was carried out using “Linear Array HPV Genotyping Test” kit (Roche Molecular Diagnostics). In our study, we analyzed positive samples for HPV genotype 18 (both single infections and multiple HPV infections) from patients who had given written, informed consent.

                    Genomic DNA extraction

                    DNA extraction was performed by QIAamp DNA mini Kit (Qiagen, Hilden, Germany), according to the manufacturer´s instructions. Extracted DNA was eluted with 200 μl AE buffer and stored at −20°C until amplification.

                    PCR amplification and sequencing

                    Amplification of HPV E6, E7, E4 genes and the URR was performed using type-specific primers designed according to HPV 18 genome prototype sequence (GenBank accession number NC001357). The URR was amplified using 2 primer sets. In order to amplify L1 region, consensus HPV primers were used (Table 3).
                    Table 3

                    Polymerase chain reaction characteristics for Human papillomavirus 18

                     

                    Primer sequence (5′ – 3′)

                    Annealing Temp/Cycles

                    Nucleotides amplified*

                    Amplicon size

                    E6 F

                    AGTAACCGAAAACGGTCGGGA

                    55°C/40 cycles

                    38-491

                    454 pb

                    E6 R

                    GTTGTGAAATCGTCGTTTTTCA

                       

                    E7 F

                    TGAAAAACGACGATTTCACAAC

                    55°C/40 cycles

                    470-931

                    462 pb

                    E7 R

                    ACCTTCTGGATCAGCCATTG

                       

                    E4 F

                    GTAAAGGAAGGGTACAACACG

                    57°C/35 cycles

                    3309-3792

                    484 pb

                    E4 R

                    CTGTCCAATGCCAGGTGGA

                       

                    LCR 1 F

                    TCGGTTGCCTTTGGCTTAT

                    55°C/40 cycles

                    7465-7775

                    311 pb

                    LCR 1 R

                    AAGGGTAGACAGAATGTTGGACA

                    55°C/40 cycles

                    7718-163

                    303 pb

                    LCR 2 F

                    GCTAATTGCATACTTGGCTTG

                       

                    LCR 2 R

                    TCCGTGCACAGATCAGGTAG

                       

                    MY11

                    GCACAGGGTCATAACAATGG

                    55°C/40 cycles

                    6558-7012

                    455 pb

                    MY09

                    CGTCCAAGGGATATTGATC

                       

                    L1 seq

                    ACAGTCTCCTGTACCTGGG

                       

                    *Position numbering refers to the first nucleotide of the HPV 18 reference genome (accession number NC001357). F: forward primer, R: reverse primer.

                    PCR was performed in 30 μl of reaction mixture containing 10 × PCR buffer, 25 mmol/L MgCl2, 25 mmol/L of each deoxynucleoside, 100 pmol/L of sense and anti-sense primer, 5 μl of template DNA and 2,5 U of Taq DNA polymerase (Qiagen).

                    The thermal program started with a pre-heat of 95°C for 15 min, followed by 35–40 cycles of suitable annealing temperature which depended on the primers and finished with a final extension at 72°C for 10 min (Table 3).

                    PCR products were confirmed based on specific bands of amplified DNA presence in agarose gel (2%). Afterwards, amplimers were automatically sequenced using the “Big Dye Terminator Cycle Sequencing kit” (Applied Biosystems) according to the manufacturer´s instructions.

                    For E6, E7, E4 and URR amplicons the same forward specific primers as those used in amplification were chosen as sequencing primers. In the L1 region, a specific primer was used in order to sequence HPV 18 and not other HPV types present in cases of multiple infection (Table 3).

                    Nucleotide variations, phylogenetic analysis: variants and recombination

                    HPV sequences were aligned and compared to the HPV 18 prototype sequence which belongs to the Asian-amerindian lineage (accession number NC001357), using BioEdit Sequence Alignment Editor v7.0.4.1 and Clustal W (http://​www.​genome.​jp/​tools/​clustalw/​).

                    Amplification and sequencing of the samples were repeated to confirm nucleotide variations which were present in less than three isolates.

                    Sequences were assigned to a lineage on the basis of their similarity to HPV 18 known variant sequences [26] which belong to Asian-amerindian lineage (GenBank accession numbers: EF202143 - EF202146), African (EF202152 - EF202155) and European lineage (EF202147- EF202149, EF202151). Phylogenetic trees were built using the Bayesian inference method implemented in MrBayes 3.1 [27] and three methods (all implemented in RDP3 [15]) were used for the detection of recombination (RDP [15], Maxchi [16] and Chimaera) to analyze isolates which did not adjust to the clusters.

                    Lesions

                    Association of lesions and variants or infection type (single HPV vs multiple HPV infection) was analyzed. Fisher exact test was used for statistically significant association.

                    GenBank accession numbers

                    The following are the GenBank accession numbers for all the sequences used in this analysis. X indicates absence of nucleotide sequence data Table 4.
                    Table 4

                    GeneBank accession numbers for the sequenced isolates

                    Isolate

                    E6

                    E7

                    E4

                    L1

                    URR

                    LSM1

                    JN416211

                    JN416162

                    X

                    JN416262

                    JN416313

                    LSM2

                    JN416212

                    JN416163

                    JN416121

                    JN416263

                    JN416314

                    LSM3

                    JN416213

                    JN416164

                    X

                    X

                    JN416315

                    LSM4

                    JN416214

                    JN416165

                    JN416122

                    JN416264

                    JN416316

                    LSC5

                    JN416215

                    JN416166

                    JN416123

                    JN416265

                    JN416317

                    LSM6

                    JN416216

                    X

                    X

                    JN416266

                    JN416318

                    LSM7

                    JN416217

                    JN416167

                    JN416124

                    JN416267

                    JN416319

                    LSC9

                    JN416219

                    JN416169

                    JN416125

                    JN416269

                    JN416321

                    LSCA

                    JN416220

                    JN416170

                    X

                    JN416270

                    JN416322

                    LSCB

                    JN416221

                    JN416171

                    JN416126

                    JN416271

                    JN416323

                    LSCC

                    JN416222

                    JN416172

                    JN416127

                    JN416272

                    JN416324

                    LSCD

                    JN416223

                    JN416173

                    X

                    JN416273

                    JN416325

                    LSCE

                    JN416224

                    JN416174

                    JN416128

                    JN416274

                    JN416326

                    LSCF

                    X

                    X

                    X

                    JN416275

                    JN416327

                    LSCG

                    JN416225

                    JN416175

                    X

                    JN416276

                    JN416328

                    LSCH

                    JN416226

                    JN416176

                    JN416129

                    JN416277

                    JN416329

                    LSCI

                    JN416227

                    JN416177

                    JN416130

                    JN416278

                    JN416330

                    LSCJ

                    JN416228

                    JN416178

                    JN416131

                    JN416279

                    JN416331

                    LSCK

                    JN416229

                    JN416179

                    JN416132

                    JN416280

                    JN416332

                    LSCL

                    JN416230

                    JN416180

                    JN416133

                    JN416281

                    JN416333

                    LSCM

                    JN416231

                    JN416181

                    JN416134

                    JN416282

                    JN416334

                    LSCP

                    JN416232

                    JN416182

                    JN416135

                    JN416283

                    JN416335

                    LSCR

                    JN416234

                    JN416184

                    JN416137

                    JN416285

                    JN416337

                    LSCS

                    JN416235

                    X

                    JN416138

                    JN416286

                    JN416338

                    LSCW

                    JN416238

                    JN416187

                    JN416141

                    JN416289

                    JN416341

                    LSCX

                    JN416239

                    JN416188

                    JN416142

                    JN416290

                    JN416342

                    LSCY

                    JN416240

                    JN416189

                    JN416143

                    JN416291

                    JN416343

                    LSCA1

                    JN416241

                    JN416190

                    JN416144

                    JN416292

                    JN416344

                    LSCC1

                    JN416243

                    JN416192

                    JN416146

                    JN416294

                    JN416346

                    LSCE1

                    JN416245

                    JN416194

                    X

                    JN416296

                    JN416348

                    LSMF1

                    JN416246

                    JN416195

                    JN416147

                    JN416297

                    JN416349

                    LSMG1

                    JN416247

                    JN416196

                    JN416148

                    JN416298

                    JN416350

                    LSCH1

                    JN416248

                    JN416197

                    JN416149

                    JN416299

                    JN416351

                    LSCI1

                    JN416249

                    JN416198

                    JN416150

                    JN416300

                    JN416352

                    LSCJ1

                    JN416250

                    JN416199

                    JN416151

                    JN416301

                    JN416353

                    LSMK1

                    JN416251

                    JN416200

                    JN416152

                    JN416302

                    JN416354

                    LSML1

                    JN416252

                    JN416201

                    JN416153

                    JN416303

                    JN416355

                    LSCM1

                    JN416253

                    JN416202

                    JN416154

                    JN416304

                    JN416356

                    LSCP1

                    JN416256

                    JN416205

                    JN416157

                    JN416307

                    JN416359

                    LSCQ1

                    JN416257

                    JN416206

                    JN416158

                    JN416308

                    JN416360

                    LSCR1

                    JN416258

                    JN416207

                    JN416159

                    JN416309

                    JN416361

                    LSCS1

                    JN416259

                    JN416208

                    JN416160

                    JN416310

                    JN416362

                    LSCT1

                    JN416260

                    JN416209

                    X

                    JN416311

                    JN416363

                    LSCU1

                    JN416261

                    JN416210

                    JN416161

                    JN416312

                    JN416364

                    Ethical approval

                    All procedures followed were approved by the appropriate Ethics Commitee related to our institutions (Basurto University Hospital and University of Basque Country) and complied with the guidelines and ethical standards for experimental investigation with human subjects of Helsinki Declaration of 1975, as revised in 2000. All study participants provided written, informed consent.

                    Abbreviations

                    HPV: 

                    Human papillomavirus

                    H-SIL: 

                    High-grade squamous intraepithelial lesion

                    L-SIL: 

                    Low-grade squamous intraepithelial lesion

                    SIL: 

                    Squamous intraepithelial lesion

                    URR: 

                    Upstream regulatory region.

                    Declarations

                    Acknowledgements

                    Authors wish to thank the Department of Health from the Basque Government for supporting this project [project number 2008111058].

                    Authors’ Affiliations

                    (1)
                    Immunology, Microbiology and Parasitology Department, University of Basque Country
                    (2)
                    Clinical Microbiology and Infection Control Department, Basurto University Hospital
                    (3)
                    Obstetrics and Gynecology Department, Basurto University Hospital
                    (4)
                    Genetics, Physical Anthropology and Animal Physiology Department, University of Basque Country

                    References

                    1. Muñoz N, Castellsague X, de Gonzalez AB, Gissmann L: HPV in the etiology of human cancer. Vaccine 2006, 24:1–10.View Article
                    2. Smith JS, Lindsay L, Hoots B, Keys J, Franceschi S, Winer R, et al.: Human papillomavirus type distribution in invasive cervical cancer and high-grade cervical lesions: a meta-analysis update. Int J Cancer 2007, 121:621–632.PubMedView Article
                    3. Muñoz N, Bosch FX, Castellsagué X, Díaz M, de Sanjose S, Hammouda D, et al.: Against which human papillomavirus types shall we vaccinate and screen? the international perspective. Int J Cancer 2004, 111:278–285.PubMedView Article
                    4. Yamada T, Manos MM, Peto J, Greer CE, Munoz N, Bosch FX, et al.: Human papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J Virol 1997, 71:2463–2472.PubMed
                    5. Ong CK, Chan SY, Campo MS, Campo MS, Fujinaga K, Mavromara-Nazos P, et al.: Evolution of human papillomavirus type 18: an ancient phylogenetic root in Africa and intratype diversity reflect coevolution with human ethnic groups. J Virol 1993, 67:6424–6431.PubMed
                    6. de Araujo Souza PS, Sichero L, Macia PC: HPV variants and HLA polymorphisms: the role of variability on the risk of cervical cancer. Future Oncol 2009, 5:359–370.PubMedView Article
                    7. Sichero L, Ferreira S, Trottier H, Duarte-Franco E, Ferenczy A, Franco EL, et al.: High grade cervical lesions are caused preferentially by non-european variants of HPVs 16 and 18. Int J Cancer 2007, 120:1763–1768.PubMedView Article
                    8. López-Savedra A, González-Maya L, de Ponce León S, García-Carranca A, Mohar A, Lizano M: Functional implication of sequence variation in the long control region and E2 gene among human papillomavirus type 18 variants. Arch Virol 2009, 154:747–754.View Article
                    9. de Villiers EM, Fauquet C, Broker TR, Bernard HU, Zur HH: Classification of papillomaviruses. Virology 2004, 324:17–27.PubMedView Article
                    10. Angulo M, Carvajal-Rodríguez A: Evidence of recombination within human alpha-papillomavirus. Virol J 2007, 4:33.PubMedView Article
                    11. Jiang M, Xi LF, Edelstein ZR, Galloway DA, Olsem GJ, Lin WC, et al.: Identification of recombinant human papillomavirus type 16 variants. Virology 2009, 394:8–11.PubMedView Article
                    12. Méndez F, Muñoz N, Posso H, Molano M, Moreno V, van den Brule AJ, et al.: Cervical coinfection with human papillomavirus (HPV) types and possible implications for the prevention of cervical cancer by HPV vaccines. J Infect Dis 2005, 192:1158–1165.PubMedView Article
                    13. Tinelli A, Leo G, Dell’Edera D, Storelli F, Galante MM, Guido M, et al.: Molecular methods for a correct diagnosis of multiple HPV infections and clinical implications for vaccine. Int J Gynecol Cancer 2011, 21:545–550.PubMedView Article
                    14. Nielson CM, Harris RB, Flores R, Abrahamsen M, Papenfuss MR, Dunne EF, et al.: Multiple-type human papillomavirus infection in male anogenital sites: prevalence and associated factors. Cancer Epidemiol Biomarkers Prev 2009, 18:1077–1083.PubMedView Article
                    15. Martin DP, Lemey P, Lott M, Moulton V, Posada D, Lefeuvre P: RDP3: a flexible and fast computer program for analyzing recombination. Bioinformatics 2010, 26:2462–2463.PubMedView Article
                    16. Smith J: Analyzing the mosaic structure of genes. J Mol Evol 1992, 34:126–129.PubMed
                    17. Xi LF, Kiviat NB, Hildesheim A, Galloway DA, Wheeler CM, Ho J, et al.: Human papillomavirus type 16 and 18 variants: race-related distribution and persistence. J Natl Cancer Inst 2006, 98:1045–1052.PubMedView Article
                    18. Im SS, Wilczynski SP, Burge RA, Monk BJ: Early stage cervical cancers containing human papillomavirus type 18 DNA have more nodal metastasis and deeper stromal invasion. Clin Cancer Res 2003, 9:4145–4150.PubMed
                    19. Burger R, Monk BJ, Kurosaki T, Anton-Culver H, Vasiley SA, Berman ML, et al.: Human papillomavirus type 18: association with poor prognosis in early stage cancer. J Natl Cancer Inst 1996, 88:1361–1368.PubMedView Article
                    20. Hecht J, Kadish A, Jiang G, Burk R: Genetic characterization of the human papillomavirus (HPV) 18 E2 gene in clinical specimens suggests the presence of a subtype with decreased oncogenic potential. Int J Cancer 1995, 60:369–376.PubMedView Article
                    21. Villa LL, Sichero L, Rahal P, Caballero O, Ferenczy A, Rohan T, et al.: Molecular variants of human papillomavirus types 16 and 18 preferentially associated with cervical neoplasma. J Gen Virol 2000, 81:2959–2968.PubMed
                    22. Rose B, Steger G, Dong XP, Thompson C, Cossart Y, Tattersall M, et al.: Point mutations in SP1 motifs in the upstream regulatory region of human papillomavirus type 18 isolates from cervical cancers increase promoter activity. J Gen Virol 1998, 79:1659–1663.PubMed
                    23. Rose B, Thompson CH, Zhang J, Stoeter M, Stephen A, Pfister H, et al.: Sequence variation in the upstream regulatory region of HPV 18 isolates from cervical cancers. Gynecol Oncol 1997, 66:282–289.PubMedView Article
                    24. Meissner J, et al.: Sequencing errors in reference HPV clones. In Human papillomaviruses. A compilation and analysis of nucleic acid and amino acid sequences. 3rd edition. Edited by: Myers G, Baker C, Munger K. Los Alamos (NM): Theoretical Biology and Biophysics, Los Alamos National Laboratory; 1997:110–123.
                    25. Arias-Pulido H, Peyton CL, Torrez-Martinez N, Anderson DN, Wheeler CM: Human papillomavirus type 18 variant lineages in United States populations characterized by sequence analysis of LCR-E6, E2, and L1 regions. Virology 2005, 338:22–34.PubMedView Article
                    26. Chen Z, DeSalle R, Schiffmn M, Herrero R, Burk RD: Evolutionary dynamics of variant genomes of human papillomavirus types 18, 45 and 97. J Virol 2009, 83:1443–1455.PubMedView Article
                    27. Ronquist F, Huelsenbeck JP: MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19:1572–1574.PubMedView Article

                    Copyright

                    © Arroyo et al.; licensee BioMed Central Ltd. 2012

                    This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                    Advertisement