Co-circulation of two genotypes of dengue virus serotype 3 in Guangzhou, China, 2009

  • Tao Jiang1Email author,

    Affiliated with

    • Xue-Dong Yu1Email author,

      Affiliated with

      • Wen-Xin Hong2Email author,

        Affiliated with

        • Wei-Ze Zhou3,

          Affiliated with

          • Man Yu1,

            Affiliated with

            • Yong-Qiang Deng1,

              Affiliated with

              • Shun-Ya Zhu1,

                Affiliated with

                • E-De Qin1,

                  Affiliated with

                  • Jian Wang2,

                    Affiliated with

                    • Cheng-Feng Qin1Email author and

                      Affiliated with

                      • Fu-Chun Zhang2Email author

                        Affiliated with

                        Virology Journal20129:125

                        DOI: 10.1186/1743-422X-9-125

                        Received: 25 November 2011

                        Accepted: 14 June 2012

                        Published: 22 June 2012

                        Abstract

                        Dengue is emerging as the most important mosquito borne viral disease in the world. In mainland China, sporadic and large outbreaks of dengue illness caused by the four serotypes of dengue virus (DENV-1 to DENV-4) have been well documented. Guangdong province is the major affected area in China, and DENV-1 has dominantly circulated in Guangdong for a long time. In this study, a family cluster of DENV-3 infection in Guangzhou was described. Three cases were diagnosed as dengue fever based on clinical manifestation, serological and RT-PCR assays. Two DENV-3 strains were isolated in C6/36 cells and the complete genome sequences were determined. Phylogenetic analysis revealed that the new DENV-3 isolates from the family cluster were grouped within genotype III. Considering the fact that several DENV-3 strains within genotype V were also identified in Guangzhou in 2009, at least two genotypes of DENV-3 co-circulated in Guangzhou. Careful investigation and virological analysis should be warranted in the future.

                        Keywords

                        Dengue virus type 3 Family cluster Genotype Co-circulation

                        Background

                        Dengue is increasing in both frequency and magnitude worldwide, posing a heavy public health and economic burden especially in tropical and subtropical countries. Today, dengue ranks as the most important mosquito-borne viral disease in the world. Annually, up to 50 million human infections occur with 22, 000 deaths mainly in children [1]. Even, population growth, urbanization, international travel, and global warming continuously enhance vector transmission and disease outbreaks [2]. Dengue virus (DENV) contains four serotypes, and each of them can cause a wide spectrum of clinical manifestations, including mild dengue fever (DF), severe dengue haemorrhagic fever (DHF) and deadly dengue shock syndrome (DSS). Although intensive efforts have been made for decades, no preventive vaccines or antiviral drugs is currently available. The pathogenesis of DHF and DSS remains poorly understood. However, secondary infection with another DENV serotypes clearly increased the risk of severe diseases via the mechanism of antibody dependent enhancement (ADE) [35]. Epidemiological and in vivo data also indicated that anti-DENV antibodies mediated pathogenesis of a second heterotypic DENV infection [68].

                        Mainland China has experienced large outbreaks of DF during World War II, after that dengue disappeared for about 30 years. Since 1978, mainland China has seen a resurgence of dengue, epidemics involving hundreds of thousands of people have occurred in many provinces of Southern China, including Hainan, Guangdong, Guangxi, Fujian, Yunnan and Zhejiang provinces [914]. Currently, DF is listed as the notifiable infectious disease by the Ministry of Health, China. The recent epidemiology of dengue in China is characterized by a 3–5 year cycle. Most cases are DF, and only a few DHF or DSS cases have been reported over the last decade in mainland China [9, 10, 13].

                        In dengue endemic country, the presence of four serotypes of DENV is common, and co-circulation of multiple dengue serotypes in the same area has been well documented [1517]. Guangdong province has been recognized as the major affected area of China. Although all four serotypes of DENV have been isolated in China, the dominant serotype circulating in Guangdong is DENV-1, no other serotypes has been recorded since 2001 [9, 10, 13, 18]. Large DF outbreaks involving more than 1000 cases caused by DENV-1 have been described in Guangdong, China in 2002 and 2006, respectively [13, 19].

                        In this study, we sought to determine the cause of a family cluster of DF in Guangzhou, Guangdong province, China in 2009, and analyze the possible origin of these emerging isolates responsible for the epidemic.

                        Materials and methods

                        Case description

                        On Aug 6, 2009, three adult family members admitted to Guangzhou No.8 People’s Hospital as suspected DF cases. The 30-year-old son firstly had a sudden fever with headache, then his father (56-year-old) and mother (50-year-old) fell ill subsequently in the following two days. All the three cases developed typical DF symptoms, including fever, headache, chills, rash, muscle and joint pain, and anorexia. The couples developed diarrhoea, and none of them showed vomiting. The tourniquet tests were all positive. All patients recovered uneventfully and discharged on Aug 11, 2009.

                        Ethics statement

                        The research was approved by the Review Board of Guangzhou No.8 People’s Hospital and the Ethical Committee of State Key Laboratory of Pathogen and Biosecurity. Informed consent was obtained from patients.

                        Serological assay and RT-PCR

                        Acute phrase sera were subjected to serological assays using IgM and IgG capture ELISA kit (PanBio, Queensland, Australia) according to the manufacturer’s instruction. RT-PCR assays were performed to detect and typing of DENVs as previously described [20].

                        Virus isolation and identification

                        Acute phase sera from the three patients were inoculated in C6/36 mosquito cells (Aedesalbopitus clone) and maintained in 1640 medium (Life Technologies, CA, USA) supplement with 2% fetal bovine serum (Life Technologies) at 28 °C in 5% CO2. When complete cytopathic effects (CPE) were observed, culture supernatants from positive samples were collected and stored at −70 °C until use. Indirect immunofluscence assay (IFA) was performed as previously described [21].

                        Sequencing of complete genome of DENV-3 isolates

                        The viral RNA was extracted from 200 μl of DENV-3 infected C6/36 culture supernatant using Purelink RNA mini kit (Life Technologies) in accordance with the manufacturer’s instructions. A total of 11 overlapping amplicons spanning the complete genomic region were amplified using 11 pairs of primers. The PCR products were sequenced and assembled. The 5’ and 3’ untranslated regions (UTRs) of viral genome of each isolate were determined using a rapid amplification of either 5’ or 3’ cDNA ends (RACE) kit (Roche, Mannheim, Germany) followed the manufacturer’s recommendation. All primers can be found in Table 1.
                        Table 1

                        Primers used for sequencing reactions

                        Primer Name

                        Location a

                        Sequence (5'-3')

                        Product (bp)

                        F1

                        1-22

                        AGTTGTTAGTCTACGTGGACCG

                        1054

                        R1

                        1036-1054

                        CGTGGGCTTGTTCTTAGCC

                         

                        F2

                        857-877

                        GCCCATTACATAGGCACTTCC

                        1199

                        R2

                        2036-2055

                        CTTTCCCCAAAAGGAGGTTC

                         

                        F3

                        1946-1965

                        GAGGATGGACAAGGGAAAGC

                        1403

                        R3

                        3326-3348

                        CACCATTCGTGTATCAACTTCCC

                         

                        F4

                        3224-3245

                        GGAAAATTGGAGCTGGACTTCA

                        1001

                        R4

                        4206-4224

                        GCCACTAATGGTCCAGCCA

                         

                        F5

                        4112-4131

                        CTCAAAAGGAGAAGCTGGCC

                        1208

                        R5

                        5299-5319

                        CGCATTGTGAACGTTGCGTG

                         

                        F6

                        5252-5274

                        GCAACAAAATCTGAACACACAGG

                        1071

                        R6

                        6301-6321

                        GAATAAGTGCGGGCATCAAGC

                         

                        F7

                        6059-6077

                        AAGTCAGCCGCCATAGACG

                        1389

                        R7

                        7428-7447

                        AGGTGATCCTTCCCAGAGTG

                         

                        F8

                        7032-7049

                        AGGCAGTGGTCCTGATGG

                        1143

                        R8

                        8153-8174

                        GCATTCCTCCATGTTTCCTTTG

                         

                        F9

                        8015-8032

                        TCACCAAGCCCAACAGTG

                        1528

                        R9

                        9520-9542

                        TGGCCATTCTTTTTAACCTCTCC

                         

                        F10

                        9270-9293

                        AGCTCACATACCAAAACAAAGTGG

                        1060

                        R10

                        10299-10318

                        AGCTTCTTCCGTACTGTGGC

                         

                        F11 b

                        10118-10137

                        GGTCTCACTTCCAGAGCAAC

                        590

                        R11

                        10674-10696

                        AGAACCTGTTGATTCAACAGCAC

                         

                        5'RACE outer primer

                        661-678

                        TTGCACGTTCCATAGGTC

                         

                        5'RACE inner primer

                        267-284

                        CTGCTGTTGGTGGAATGG

                         

                        a Primer location refers to DENV-3 strain 80–2 [GenBank: AF317645].

                        b Primer F11 was also used as 3’RACE primer.

                        Sequence alignment and phylogenetic analysis

                        The complete nucleotide sequences of the complete sequences of coding region or envelope (E) gene of global DENV-3 strains were retrieved from GenBank (Table 2). Multiple sequence alignment was carried out employing the CLUSTAL W program [22]. Phylogenetic analyses based on the nucleotide sequence of complete coding region of 44 DENV-3 or complete envelope gene of 58 DENV-3 were carried out by Neighbor-Joining method using MEGA version 5.05 or by Bayesian method using BEAST version 1.7.1 [23, 24]. The Neighbor-Joining trees were constructed by Tamura-Nei model with gamma-distribution of among-site [25]. The Bayesian trees were inferred by Markov Chain Monte Carlo (MCMC) for 5,000,000 generations, sampling at every 100 the generations. Sequences of the DENV-1 strain WestPac [GenBank: U88535], DENV-2 strain NGC [GenBank: AF038403] and DENV-4 strain B5 [GenBank: AF289029] were used as outgroups.
                        Table 2

                        DENV-3 isolates investigated in this study

                        Isolate

                        Year of isolation

                        Geographical origin

                        GenBank Accession No.

                        Genotype

                        GZ1D3

                        2009

                        China: Guangdong

                        In this study

                        III

                        GZ2D3

                        2009

                        China: Guangdong

                        In this study

                        III

                        09/GZ/11144

                        2009

                        China: Guangdong

                        HM466966 (E)

                        III

                        09/GZ/11194

                        2009

                        China: Guangdong

                        HM466967 (E)

                        III

                        09/GZ/13105

                        2009

                        China: Guangdong

                        HM466968 (E)

                        III

                        09/GZ/10616

                        2009

                        China: Guangdong

                        HM466964 (E)

                        III

                        Zhejiang/08/09

                        2009

                        China: Zhejiang

                        GU721065

                        III

                        Zhejiang/15/09

                        2009

                        China: Zhejiang

                        GU721066

                        III

                        Zhejiang/17/09

                        2009

                        China: Zhejiang

                        GU721067

                        III

                        Zhejiang/27/09

                        2009

                        China: Zhejiang

                        GU721068

                        III

                        Zhejiang/31/09

                        2009

                        China: Zhejiang

                        GU721069

                        III

                        ZJYW2009

                        2009

                        China: Zhejiang

                        JF504679

                        III

                        07CHLS001

                        2007

                        China: Zhejiang

                        EU367962

                        II

                        DTID-ZJU04

                        2009

                        China: Zhejiang

                        GU189648

                        II

                        09/GZ/1081

                        2009

                        China: Guangdong

                        HM466962 (E)

                        V

                        09/GZ/1483

                        2009

                        China: Guangdong

                        HM466963 (E)

                        V

                        09/GZ/10806

                        2009

                        China: Guangdong

                        HM466965 (E)

                        V

                        80-2

                        1980

                        China: Guangxi

                        AF317645

                        V

                        ND143

                        2007

                        India

                        FJ644564

                        III

                        DEL-72

                        2008

                        India

                        GQ466079

                        III

                        DENV-3/LK/BID-V2405

                        1983

                        Sri Lanka

                        GQ199887

                        III

                        DENV-3/LK/BID-V2409

                        1997

                        Sri Lanka

                        GQ252674

                        III

                        DENV-3/MX/BID-V2989

                        2007

                        Mexico

                        FJ898442

                        III

                        DENV-3/US/BID-V2103

                        2000

                        USA

                        FJ547071

                        III

                        DENV-3/US/BID-V1080

                        2006

                        USA

                        EU529699

                        III

                        DENV-3/US/BID-V1620

                        2005

                        USA

                        FJ182010

                        III

                        DENV-3/US/BID-V1090

                        1998

                        USA

                        EU529703

                        III

                        DENV-3/US/BID-V1043

                        2006

                        USA

                        EU482555

                        III

                        DENV-3/VE/BID-V2179

                        2000

                        Venezuela

                        FJ639750

                        III

                        DENV-3/VE/BID-V2481

                        2007

                        Venezuela

                        GQ868586

                        III

                        DENV-3/NI/BID-V2419

                        1998

                        Nicaragua

                        GQ199886

                        III

                        DENV-3/NI/BID-V2420

                        1994

                        Nicaragua

                        FJ882576

                        III

                        DENV-3/NI/BID-V2649

                        2008

                        Nicaragua

                        FJ873813

                        III

                        DENV-3/NI/BID-V4761

                        2009

                        Nicaragua

                        HM181972

                        III

                        DENV-3/NI/BID-V3055

                        2008

                        Nicaragua

                        GQ199860

                        III

                        DENV-3/NI/BID-V5498

                        2010

                        Nicaragua

                        JF937633

                        III

                        DENV-3/LC/BID-V3929

                        2001

                        Saint Lucia

                        GQ868616

                        III

                        DENV-3/BR/BID-V2400

                        2007

                        Brazil

                        FJ850092

                        III

                        DENV-3/BR/BID-V2977

                        2001

                        Brazil

                        FJ898446

                        III

                        DENV-3/BR/BID-V3606

                        2007

                        Brazil

                        GU131876

                        III

                        DENV-3/IPC/BID-V3832

                        2007

                        Cambodia

                        GU131917

                        II

                        DENV-3/KH/BID-V2082

                        2003

                        Cambodia

                        FJ639725

                        II

                        DENV-3/IPC/BID-V3820

                        2006

                        Cambodia

                        GU131908

                        II

                        DENV-3/IPC/BID-V4286

                        2007

                        Cambodia

                        GU131937

                        II

                        DENV-3/KH/BID-V2080

                        2003

                        Cambodia

                        FJ639723

                        II

                        DENV-3/VN/BID-V1013

                        2006

                        Viet Nam

                        EU482457

                        II

                        DENV-3/VN/BID-V1911

                        2008

                        Viet Nam

                        FJ547066

                        II

                        C0360/94

                        1994

                        Thailand

                        AY923865

                        II

                        C0331/94

                        1994

                        Thailand

                        AY876494

                        II

                        DENV-3/TH/BID-V2315

                        2001

                        Thailand

                        FJ744729

                        II

                        DENV-3/TH/BID-V3360

                        1973

                        Thailand

                        GQ868593

                        II

                        PF90/3050

                        1990

                        French Polynesia

                        AY744679

                        I

                        PF92/4190

                        1992

                        French Polynesia

                        AY744684

                        I

                        den3-88

                        1988

                        Indonesia

                        AY858038

                        I

                        FW01

                        2004

                        Indonesia

                        AY858040

                        I

                        H87

                        1956

                        Philippines

                        M93130

                        V

                        BS-PRico63

                        1963

                        Puerto Rico

                        AY146762

                        IV

                        1339

                        1977

                        Puerto Rico

                        AY146761

                        IV

                        Results

                        All three family members were diagnosed as DF according to the new guideline of World Health Organization [26]. Laboratory tests disclosed low WBC and lymphocytes counts for all the three cases. Normal platelet counts were recorded for two cases, while that of the mother was low. None of the patients presented plasma leakage, severe bleeding, or severe organ involvement. All cases recovered in a week post admission.

                        The acute phase sera from all the three family members were positive for dengue IgM antibody, but negative for IgG antibody. Two of the three cases were positive for DENV-specific RT-PCR. DNA sequencing of the PCR products and blast analysis revealed closely homologous with DENV-3. Considering the fact that DENV-3 has not been described in Guangdong for many years, all the three samples were inoculated into C6/36 cells to isolate the viruses. Typical CPE were observed six or seven days post inoculation for two of three samples. After another passage in C6/36 cells, two strains were isolated and named with GZ1D3 and GZ2D3, respectively. Both strains were further confirmed by IFA using dengue specific monoclonal antibody.

                        Finally, the complete genome sequences of the isolates were determined, assembled and submitted to GenBank [GenBank: GU363549; JN662391]. Both strains were highly homologous (99.9%) with only three nucleotide differences. Phylogenetic analysis based on the complete envelope gene classified DENV-3 isolates into five genotypes (Figure 1), which was confirmed by the Bayesian method (Additional file 1: Figure S1). Phylogenetic tree based on the complete sequence of coding region of DENV-3 genome showed the same genotype classification (Figure 2). The newly isolated DENV-3 strains belong to the genotype III, clustering with other DENV-3 isolates circulating in China in 2009 and in India in 2007 and 2008 (Figure 1). Interestingly, three additional DENV-3 strains isolated in Guangzhou in 2009 (09/GZ/1081, 09GZ/1483 and 09/GZ/10806) [27] belong to genotype V (Figure 1 & Additional file 1: Figure S1), which indicated that two genotypes of DENV-3 were co-circulating in Guangdong, 2009.
                        http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-125/MediaObjects/12985_2011_1812_Fig1_HTML.jpg
                        Figure 1

                        Phylogenetic tree based on the complete envelope gene from 58 DENV-3 strains sampled globally. The evolutionary history was inferred using the neighbor-joining method with MEGA 5 software [24]. Each strain is abbreviated with strain name and country of origin followed by the year of isolation. Bootstrap values greater than 0.9 based on 1000 replicates are shown for key nodes. The tree was rooted using DENV-1 strain Nauru, DENV-2 strain New Guinea C and DENV-4 strain B5 as outgroups. The newly DENV-3 isolates in the study are marked with red squares and other Chinese DENV-3 isolates taken for comparison are marked with blue squares.

                        http://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-125/MediaObjects/12985_2011_1812_Fig2_HTML.jpg
                        Figure 2

                        Phylogenetic tree based on complete sequences of coding region of viral genome from 44 DENV-3 strains sampled globally. The evolutionary history was inferred using the neighbor-joining method with MEGA 5 software [24]. Bootstrap values greater than 0.9 based on 1000 replicates are shown for key nodes. The tree was rooted using DENV-1 strain Nauru, DENV-2 strain New Guinea C and DENV-4 strain B5 as outgroups. The newly DENV-3 isolates in the study are marked with red squares and other Chinese DENV-3 isolates taken for comparison are marked with blue squares.

                        Discussion

                        In the present study, a family cluster of DENV-3 infections in Guangzhou, China was described. Three family members were diagnosed as DF, and all recovered finally. All the three family members recalled mosquito biting before illness, and none of them went aboard or on trip recently. Although family cluster of vector-borne diseases have been intensively described [28, 29], information regarding DF family cluster is limited. There is no doubt that any cluster of cases is of great concern and should be thoroughly investigated. Dengue can cause both the large epidemics and sporadic infections. The recognition of clustering of disease is important for medical providers and public health personnel in treating and controlling the disease, because multiple infections can occur simultaneously or following an index case. In this study, strict mosquito control measures were initiated immediately after confirmation of the DF cases, and no further cases were reported nearby thereafter.

                        Whether dengue is endemic in Guangdong remains disputable. Most dengue epidemics in Guangdong were initiated by the introduction of virus from imported cases [13, 18, 19, 27, 30], however, in this study none of the family member travelled aboard. Further epidemiology investigation also did not identify imported case nearby either. The origin of these DENV-3 isolate is really interesting. Since DENV-1 has circulated in Guangzhou for about ten years, the new DENV-3 has potential to increase the rate of secondary heterotypic infection. Furthermore, the previous studies showed that epidemic DHF has appeared in association with DENV-3 [3133]. In the Americas, DENV-3 presented greater epidemic potential and virulence [20]. Whatever, the emerging DENV-3 in Guangzhou might represent a risk factor for severe dengue illness, careful investigation and surveillance should be warranted in the future.

                        Most importantly, phylogenetic analysis demonstrated that at least two different genotypes of DENV-3 were co-circulated in Guangdong, China in 2009, which partly agree with the findings of the previous study [27]. Five genotypes of DENV-3 have been reported [20, 34]. The newly isolates in Guangdong form a distinct cluster with other Chinese isolates sampled from Zhejiang province in 2009 [35]. All these genotype III DENV-3 strains were closely related to those sampled in India in 2007 and 2008, suggesting these Chinese isolates might be imported from India. Previously, the introduction of new genotype III of DENV-3 has been recognized as one of the factors leading to the emergence of DHF in Pakistan and India [33, 36]. These strains are therefore interesting and their virological characterization and virulence analyses are currently underway.

                        However, three additional DENV-3 strains (09/GZ/1081, 09GZ/1483, and 09/GZ/10806), belonging to genotype V, were also identified in Guangzhou, 2009 in a separate study [27]. In addition, two strains (07CSHL001 and DTID-ZJU04) sampled from China, were grouped within genotype II. The origin of these isolates is difficult to determine without further information. The situation that multiple genotypes of DENV-3 co-circulated in Guangzhou, China deserves close concern and careful investigation.

                        Declarations

                        Acknowledgments

                        This study was supported in part by the National Natural Science Foundation of China (No.30972613 and No.81101243), the National 973 Project of China (No.2012CB518904) and the 39th Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry. CFQ was supported by Beijing Nova Program of Science and Technology (No.2010B041).

                        Authors’ Affiliations

                        (1)
                        State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology
                        (2)
                        Guangzhou No.8 People’s Hospital, Guangzhou Medical College
                        (3)
                        The Third People’s Hospital of Huizhou

                        References

                        1. Impact of Dengue. http://​www.​who.​int/​csr/​disease/​dengue/​impact/​en/​
                        2. Weaver SC, Reisen WK: Present and future arboviral threats. Antiviral Res 2010, 85:328–345.PubMedView Article
                        3. Fried JR, Gibbons RV, Kalayanarooj S, Thomas SJ, Srikiatkhachorn A, Yoon IK, Jarman RG, Green S, Rothman AL, Cummings DA: Serotype-specific differences in the risk of dengue hemorrhagic fever: an analysis of data collected in Bangkok, Thailand from 1994 to 2006. PLoSNegl Trop Dis 2010, 4:e617.View Article
                        4. Halstead SB: Neutralization and antibody-dependent enhancement of dengue viruses. Adv Virus Res 2003, 60:421–467.PubMedView Article
                        5. Saito M, Oishi K, Inoue S, Dimaano EM, Alera MT, Robles AM, Estrella BD, Kumatori A, Moji K, Alonzo MT, et al.: Association of increased platelet-associated immunoglobulins with thrombocytopenia and the severity of disease in secondary dengue virus infections. ClinExpImmunol 2004, 138:299–303.
                        6. Dejnirattisai W, Jumnainsong A, Onsirisakul N, Fitton P, Vasanawathana S, Limpitikul W, Puttikhunt C, Edwards C, Duangchinda T, Supasa S, et al.: Cross-reacting antibodies enhance dengue virus infection in humans. Science 2010, 328:745–748.PubMedView Article
                        7. Endy TP, Nisalak A, Chunsuttitwat S, Vaughn DW, Green S, Ennis FA, Rothman AL, Libraty DH: Relationship of preexisting dengue virus (DV) neutralizing antibody levels to viremia and severity of disease in a prospective cohort study of DV infection in Thailand. J Infect Dis 2004, 189:990–1000.PubMedView Article
                        8. Goncalvez AP, Engle RE, St Claire M, Purcell RH, Lai CJ: Monoclonal antibody-mediated enhancement of dengue virus infection in vitro and in vivo and strategies for prevention. ProcNatlAcadSci U S A 2007, 104:9422–9427.View Article
                        9. Wu JY, Lun ZR, James AA, Chen XG: Dengue Fever in mainland China. AmJTrop Med Hyg 2010, 83:664–671.View Article
                        10. Wu W, Bai Z, Zhou H, Tu Z, Fang M, Tang B, Liu J, Liu L, Chen W: Molecular epidemiology of dengue viruses in southern China from 1978 to 2006. Virol J 2011, 8:322.PubMedView Article
                        11. Qiu FX, Gubler DJ, Liu JC, Chen QQ: Dengue in China: a clinical review. Bull World Health Organ 1993, 71:349–359.PubMed
                        12. Li FS, Yang FR, Song JC, Gao H, Tang JQ, Zou CH, Hu BN, Wen SR, Qiu FX: Etiologic and serologic investigations of the 1980 epidemic of dengue fever on Hainan Island, China. AmJTrop Med Hyg 1986, 35:1051–1054.
                        13. He JF, Luo HM, Liang WJ, Zheng K, Min K, Liu LP: Epidemic situation of dengue fever outbreak in Guangdong province, China, 1990–2005. Dengue Bull 2007, 31:1–9.
                        14. Wang Q, Xu Z, Dou FM, Zhou H, Wang XF, Yin WW, Li Q: Current situation and surveillance on dengue fever in China, 2005–2007. Zhonghua Liu Xing Bing XueZaZhi 2009, 30:802–806.
                        15. Bharaj P, Chahar HS, Pandey A, Diddi K, Dar L, Guleria R, Kabra SK, Broor S: Concurrent infections by all four dengue virus serotypes during an outbreak of dengue in 2006 in Delhi. India. Virol J 2008, 5:1.
                        16. Holmes EC, Tio PH, Perera D, Muhi J, Cardosa J: Importation and co-circulation of multiple serotypes of dengue virus in Sarawak, Malaysia. Virus Res 2009, 143:1–5.PubMedView Article
                        17. Lorono-Pino MA, Cropp CB, Farfan JA, Vorndam AV, Rodriguez-Angulo EM, Rosado-Paredes EP, Flores-Flores LF, Beaty BJ, Gubler DJ: Common occurrence of concurrent infections by multiple dengue virus serotypes. AmJTrop Med Hyg 1999, 61:725–730.
                        18. Chen S: The origin of dengue viruses caused the DF outbreak in Guangdong province, China, in 2006. Infect Genet Evol 2011, 11:1183–1187.PubMedView Article
                        19. Zheng K, Zhou HQ, Yan J, Ke CW, Maeda A, Maeda J, Takashima I, Kurane I, Ma H, Xie XM: Molecular characterization of the E gene of dengue virus type 1 isolated in Guangdong province, China, in 2006. Epidemiol Infect 2009, 137:73–78.PubMedView Article
                        20. Lanciotti RS, Lewis JG, Gubler DJ, Trent DW: Molecular evolution and epidemiology of dengue-3 viruses. J Gen Virol 1994,75(Pt 1):65–75.PubMedView Article
                        21. Deng YQ, Dai JX, Ji GH, Jiang T, Wang HJ, Yang HO, Tan WL, Liu R, Yu M, Ge BX, et al.: A broadly flavivirus cross-neutralizing monoclonal antibody that recognizes a novel epitope within the fusion loop of E protein. PLoS One 2011, 6:e16059.PubMedView Article
                        22. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, et al.: Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23:2947–2948.PubMedView Article
                        23. Drummond AJ, Rambaut A: BEAST: Bayesian evolutionary analysis by sampling trees. BMC EvolBiol 2007, 7:214.View Article
                        24. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. MolBiolEvol 2011, 28:2731–2739.
                        25. Saitou N, Nei M: The neighbor-joining method: a new method for reconstructing phylogenetic trees. MolBiolEvol 1987, 4:406–425.
                        26. WHO: Dengue - Guidelines for diagnosis, treatment, prevention and control. 2009. http://​www.​who.​int/​entity/​tdr/​publications/​documents/​dengue-diagnosis.​pdf
                        27. Di B, Bai ZJ, Wang YL, Luo L, Chen Y, Jiang LY, Yang ZC, Wang M: Molecular epidemiologic analysis on new emerged type 3 dengue virus in Guangzhou in 2009. Zhonghua Liu Xing Bing XueZaZhi 2010, 31:804–807.
                        28. Papa A, Bino S, Llagami A, Brahimaj B, Papadimitriou E, Pavlidou V, Velo E, Cahani G, Hajdini M, Pilaca A, et al.: Crimean-Congo hemorrhagic fever in Albania, 2001. Eur J ClinMicrobiol Infect Dis 2002, 21:603–606.View Article
                        29. Jones TF, Craig AS, Paddock CD, McKechnie DB, Childs JE, Zaki SR, Schaffner W: Family cluster of Rocky Mountain spotted fever. Clin Infect Dis 1999, 28:853–859.PubMedView Article
                        30. Yang F, Ma SQ, He JF, Mai ZJ, Liang WJ, Cai MX, Luo HM: Epidemiological analysis of imported cases of dengue fever in Guangdong province and Hong Kong during 2004–2006 in China. Zhonghua Liu Xing Bing XueZaZhi 2009, 30:42–44.
                        31. Briseno-Garcia B, Gomez-Dantes H, Argott-Ramirez E, Montesano R, Vazquez-Martinez AL, Ibanez-Bernal S, Madrigal-Ayala G, Ruiz-Matus C, Flisser A, Tapia-Conyer R: Potential risk for dengue hemorrhagic fever: the isolation of serotype dengue-3 in Mexico. Emerg Infect Dis 1996, 2:133–135.PubMedView Article
                        32. Messer WB, Gubler DJ, Harris E, Sivananthan K, de Silva AM: Emergence and global spread of a dengue serotype 3, subtype III virus. Emerg Infect Dis 2003, 9:800–809.PubMedView Article
                        33. Sharma S, Dash PK, Agarwal S, Shukla J, Parida MM, Rao PV: Comparative complete genome analysis of dengue virus type 3 circulating in India between 2003 and 2008. J Gen Virol 2011, 92:1595–1600.PubMedView Article
                        34. Wittke V, Robb TE, Thu HM, Nisalak A, Nimmannitya S, Kalayanrooj S, Vaughn DW, Endy TP, Holmes EC, Aaskov JG: Extinction and rapid emergence of strains of dengue 3 virus during an interepidemic period. Virology 2002, 301:148–156.PubMedView Article
                        35. Sun J, Lin J, Yan J, Fan W, Lu L, Lv H, Hou J, Ling F, Fu T, Chen Z, et al.: Dengue virus serotype 3 subtype III, Zhejiang Province, China. Emerg Infect Dis 2011, 17:321–323.PubMedView Article
                        36. Khan E, Hasan R, Mehraj V, Nasir A, Siddiqui J, Hewson R: Co-circulations of two genotypes of dengue virus in 2006 out-break of dengue hemorrhagic fever in Karachi, Pakistan. J ClinVirol 2008, 43:176–179.View Article

                        Copyright

                        © Jiang et al.; licensee BioMed Central Ltd. 2012

                        This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

                        Advertisement