Open Access

Co-circulation of two genotypes of dengue virus serotype 3 in Guangzhou, China, 2009

  • Tao Jiang1,
  • Xue-Dong Yu1,
  • Wen-Xin Hong2,
  • Wei-Ze Zhou3,
  • Man Yu1,
  • Yong-Qiang Deng1,
  • Shun-Ya Zhu1,
  • E-De Qin1,
  • Jian Wang2,
  • Cheng-Feng Qin1Email author and
  • Fu-Chun Zhang2Email author
Contributed equally
Virology Journal20129:125

DOI: 10.1186/1743-422X-9-125

Received: 25 November 2011

Accepted: 14 June 2012

Published: 22 June 2012

Abstract

Dengue is emerging as the most important mosquito borne viral disease in the world. In mainland China, sporadic and large outbreaks of dengue illness caused by the four serotypes of dengue virus (DENV-1 to DENV-4) have been well documented. Guangdong province is the major affected area in China, and DENV-1 has dominantly circulated in Guangdong for a long time. In this study, a family cluster of DENV-3 infection in Guangzhou was described. Three cases were diagnosed as dengue fever based on clinical manifestation, serological and RT-PCR assays. Two DENV-3 strains were isolated in C6/36 cells and the complete genome sequences were determined. Phylogenetic analysis revealed that the new DENV-3 isolates from the family cluster were grouped within genotype III. Considering the fact that several DENV-3 strains within genotype V were also identified in Guangzhou in 2009, at least two genotypes of DENV-3 co-circulated in Guangzhou. Careful investigation and virological analysis should be warranted in the future.

Keywords

Dengue virus type 3 Family cluster Genotype Co-circulation

Background

Dengue is increasing in both frequency and magnitude worldwide, posing a heavy public health and economic burden especially in tropical and subtropical countries. Today, dengue ranks as the most important mosquito-borne viral disease in the world. Annually, up to 50 million human infections occur with 22, 000 deaths mainly in children [1]. Even, population growth, urbanization, international travel, and global warming continuously enhance vector transmission and disease outbreaks [2]. Dengue virus (DENV) contains four serotypes, and each of them can cause a wide spectrum of clinical manifestations, including mild dengue fever (DF), severe dengue haemorrhagic fever (DHF) and deadly dengue shock syndrome (DSS). Although intensive efforts have been made for decades, no preventive vaccines or antiviral drugs is currently available. The pathogenesis of DHF and DSS remains poorly understood. However, secondary infection with another DENV serotypes clearly increased the risk of severe diseases via the mechanism of antibody dependent enhancement (ADE) [35]. Epidemiological and in vivo data also indicated that anti-DENV antibodies mediated pathogenesis of a second heterotypic DENV infection [68].

Mainland China has experienced large outbreaks of DF during World War II, after that dengue disappeared for about 30 years. Since 1978, mainland China has seen a resurgence of dengue, epidemics involving hundreds of thousands of people have occurred in many provinces of Southern China, including Hainan, Guangdong, Guangxi, Fujian, Yunnan and Zhejiang provinces [914]. Currently, DF is listed as the notifiable infectious disease by the Ministry of Health, China. The recent epidemiology of dengue in China is characterized by a 3–5 year cycle. Most cases are DF, and only a few DHF or DSS cases have been reported over the last decade in mainland China [9, 10, 13].

In dengue endemic country, the presence of four serotypes of DENV is common, and co-circulation of multiple dengue serotypes in the same area has been well documented [1517]. Guangdong province has been recognized as the major affected area of China. Although all four serotypes of DENV have been isolated in China, the dominant serotype circulating in Guangdong is DENV-1, no other serotypes has been recorded since 2001 [9, 10, 13, 18]. Large DF outbreaks involving more than 1000 cases caused by DENV-1 have been described in Guangdong, China in 2002 and 2006, respectively [13, 19].

In this study, we sought to determine the cause of a family cluster of DF in Guangzhou, Guangdong province, China in 2009, and analyze the possible origin of these emerging isolates responsible for the epidemic.

Materials and methods

Case description

On Aug 6, 2009, three adult family members admitted to Guangzhou No.8 People’s Hospital as suspected DF cases. The 30-year-old son firstly had a sudden fever with headache, then his father (56-year-old) and mother (50-year-old) fell ill subsequently in the following two days. All the three cases developed typical DF symptoms, including fever, headache, chills, rash, muscle and joint pain, and anorexia. The couples developed diarrhoea, and none of them showed vomiting. The tourniquet tests were all positive. All patients recovered uneventfully and discharged on Aug 11, 2009.

Ethics statement

The research was approved by the Review Board of Guangzhou No.8 People’s Hospital and the Ethical Committee of State Key Laboratory of Pathogen and Biosecurity. Informed consent was obtained from patients.

Serological assay and RT-PCR

Acute phrase sera were subjected to serological assays using IgM and IgG capture ELISA kit (PanBio, Queensland, Australia) according to the manufacturer’s instruction. RT-PCR assays were performed to detect and typing of DENVs as previously described [20].

Virus isolation and identification

Acute phase sera from the three patients were inoculated in C6/36 mosquito cells (Aedesalbopitus clone) and maintained in 1640 medium (Life Technologies, CA, USA) supplement with 2% fetal bovine serum (Life Technologies) at 28 °C in 5% CO2. When complete cytopathic effects (CPE) were observed, culture supernatants from positive samples were collected and stored at −70 °C until use. Indirect immunofluscence assay (IFA) was performed as previously described [21].

Sequencing of complete genome of DENV-3 isolates

The viral RNA was extracted from 200 μl of DENV-3 infected C6/36 culture supernatant using Purelink RNA mini kit (Life Technologies) in accordance with the manufacturer’s instructions. A total of 11 overlapping amplicons spanning the complete genomic region were amplified using 11 pairs of primers. The PCR products were sequenced and assembled. The 5’ and 3’ untranslated regions (UTRs) of viral genome of each isolate were determined using a rapid amplification of either 5’ or 3’ cDNA ends (RACE) kit (Roche, Mannheim, Germany) followed the manufacturer’s recommendation. All primers can be found in Table 1.
Table 1

Primers used for sequencing reactions

Primer Name

Location a

Sequence (5'-3')

Product (bp)

F1

1-22

AGTTGTTAGTCTACGTGGACCG

1054

R1

1036-1054

CGTGGGCTTGTTCTTAGCC

 

F2

857-877

GCCCATTACATAGGCACTTCC

1199

R2

2036-2055

CTTTCCCCAAAAGGAGGTTC

 

F3

1946-1965

GAGGATGGACAAGGGAAAGC

1403

R3

3326-3348

CACCATTCGTGTATCAACTTCCC

 

F4

3224-3245

GGAAAATTGGAGCTGGACTTCA

1001

R4

4206-4224

GCCACTAATGGTCCAGCCA

 

F5

4112-4131

CTCAAAAGGAGAAGCTGGCC

1208

R5

5299-5319

CGCATTGTGAACGTTGCGTG

 

F6

5252-5274

GCAACAAAATCTGAACACACAGG

1071

R6

6301-6321

GAATAAGTGCGGGCATCAAGC

 

F7

6059-6077

AAGTCAGCCGCCATAGACG

1389

R7

7428-7447

AGGTGATCCTTCCCAGAGTG

 

F8

7032-7049

AGGCAGTGGTCCTGATGG

1143

R8

8153-8174

GCATTCCTCCATGTTTCCTTTG

 

F9

8015-8032

TCACCAAGCCCAACAGTG

1528

R9

9520-9542

TGGCCATTCTTTTTAACCTCTCC

 

F10

9270-9293

AGCTCACATACCAAAACAAAGTGG

1060

R10

10299-10318

AGCTTCTTCCGTACTGTGGC

 

F11 b

10118-10137

GGTCTCACTTCCAGAGCAAC

590

R11

10674-10696

AGAACCTGTTGATTCAACAGCAC

 

5'RACE outer primer

661-678

TTGCACGTTCCATAGGTC

 

5'RACE inner primer

267-284

CTGCTGTTGGTGGAATGG

 

a Primer location refers to DENV-3 strain 80–2 [GenBank: AF317645].

b Primer F11 was also used as 3’RACE primer.

Sequence alignment and phylogenetic analysis

The complete nucleotide sequences of the complete sequences of coding region or envelope (E) gene of global DENV-3 strains were retrieved from GenBank (Table 2). Multiple sequence alignment was carried out employing the CLUSTAL W program [22]. Phylogenetic analyses based on the nucleotide sequence of complete coding region of 44 DENV-3 or complete envelope gene of 58 DENV-3 were carried out by Neighbor-Joining method using MEGA version 5.05 or by Bayesian method using BEAST version 1.7.1 [23, 24]. The Neighbor-Joining trees were constructed by Tamura-Nei model with gamma-distribution of among-site [25]. The Bayesian trees were inferred by Markov Chain Monte Carlo (MCMC) for 5,000,000 generations, sampling at every 100 the generations. Sequences of the DENV-1 strain WestPac [GenBank: U88535], DENV-2 strain NGC [GenBank: AF038403] and DENV-4 strain B5 [GenBank: AF289029] were used as outgroups.
Table 2

DENV-3 isolates investigated in this study

Isolate

Year of isolation

Geographical origin

GenBank Accession No.

Genotype

GZ1D3

2009

China: Guangdong

In this study

III

GZ2D3

2009

China: Guangdong

In this study

III

09/GZ/11144

2009

China: Guangdong

HM466966 (E)

III

09/GZ/11194

2009

China: Guangdong

HM466967 (E)

III

09/GZ/13105

2009

China: Guangdong

HM466968 (E)

III

09/GZ/10616

2009

China: Guangdong

HM466964 (E)

III

Zhejiang/08/09

2009

China: Zhejiang

GU721065

III

Zhejiang/15/09

2009

China: Zhejiang

GU721066

III

Zhejiang/17/09

2009

China: Zhejiang

GU721067

III

Zhejiang/27/09

2009

China: Zhejiang

GU721068

III

Zhejiang/31/09

2009

China: Zhejiang

GU721069

III

ZJYW2009

2009

China: Zhejiang

JF504679

III

07CHLS001

2007

China: Zhejiang

EU367962

II

DTID-ZJU04

2009

China: Zhejiang

GU189648

II

09/GZ/1081

2009

China: Guangdong

HM466962 (E)

V

09/GZ/1483

2009

China: Guangdong

HM466963 (E)

V

09/GZ/10806

2009

China: Guangdong

HM466965 (E)

V

80-2

1980

China: Guangxi

AF317645

V

ND143

2007

India

FJ644564

III

DEL-72

2008

India

GQ466079

III

DENV-3/LK/BID-V2405

1983

Sri Lanka

GQ199887

III

DENV-3/LK/BID-V2409

1997

Sri Lanka

GQ252674

III

DENV-3/MX/BID-V2989

2007

Mexico

FJ898442

III

DENV-3/US/BID-V2103

2000

USA

FJ547071

III

DENV-3/US/BID-V1080

2006

USA

EU529699

III

DENV-3/US/BID-V1620

2005

USA

FJ182010

III

DENV-3/US/BID-V1090

1998

USA

EU529703

III

DENV-3/US/BID-V1043

2006

USA

EU482555

III

DENV-3/VE/BID-V2179

2000

Venezuela

FJ639750

III

DENV-3/VE/BID-V2481

2007

Venezuela

GQ868586

III

DENV-3/NI/BID-V2419

1998

Nicaragua

GQ199886

III

DENV-3/NI/BID-V2420

1994

Nicaragua

FJ882576

III

DENV-3/NI/BID-V2649

2008

Nicaragua

FJ873813

III

DENV-3/NI/BID-V4761

2009

Nicaragua

HM181972

III

DENV-3/NI/BID-V3055

2008

Nicaragua

GQ199860

III

DENV-3/NI/BID-V5498

2010

Nicaragua

JF937633

III

DENV-3/LC/BID-V3929

2001

Saint Lucia

GQ868616

III

DENV-3/BR/BID-V2400

2007

Brazil

FJ850092

III

DENV-3/BR/BID-V2977

2001

Brazil

FJ898446

III

DENV-3/BR/BID-V3606

2007

Brazil

GU131876

III

DENV-3/IPC/BID-V3832

2007

Cambodia

GU131917

II

DENV-3/KH/BID-V2082

2003

Cambodia

FJ639725

II

DENV-3/IPC/BID-V3820

2006

Cambodia

GU131908

II

DENV-3/IPC/BID-V4286

2007

Cambodia

GU131937

II

DENV-3/KH/BID-V2080

2003

Cambodia

FJ639723

II

DENV-3/VN/BID-V1013

2006

Viet Nam

EU482457

II

DENV-3/VN/BID-V1911

2008

Viet Nam

FJ547066

II

C0360/94

1994

Thailand

AY923865

II

C0331/94

1994

Thailand

AY876494

II

DENV-3/TH/BID-V2315

2001

Thailand

FJ744729

II

DENV-3/TH/BID-V3360

1973

Thailand

GQ868593

II

PF90/3050

1990

French Polynesia

AY744679

I

PF92/4190

1992

French Polynesia

AY744684

I

den3-88

1988

Indonesia

AY858038

I

FW01

2004

Indonesia

AY858040

I

H87

1956

Philippines

M93130

V

BS-PRico63

1963

Puerto Rico

AY146762

IV

1339

1977

Puerto Rico

AY146761

IV

Results

All three family members were diagnosed as DF according to the new guideline of World Health Organization [26]. Laboratory tests disclosed low WBC and lymphocytes counts for all the three cases. Normal platelet counts were recorded for two cases, while that of the mother was low. None of the patients presented plasma leakage, severe bleeding, or severe organ involvement. All cases recovered in a week post admission.

The acute phase sera from all the three family members were positive for dengue IgM antibody, but negative for IgG antibody. Two of the three cases were positive for DENV-specific RT-PCR. DNA sequencing of the PCR products and blast analysis revealed closely homologous with DENV-3. Considering the fact that DENV-3 has not been described in Guangdong for many years, all the three samples were inoculated into C6/36 cells to isolate the viruses. Typical CPE were observed six or seven days post inoculation for two of three samples. After another passage in C6/36 cells, two strains were isolated and named with GZ1D3 and GZ2D3, respectively. Both strains were further confirmed by IFA using dengue specific monoclonal antibody.

Finally, the complete genome sequences of the isolates were determined, assembled and submitted to GenBank [GenBank: GU363549; JN662391]. Both strains were highly homologous (99.9%) with only three nucleotide differences. Phylogenetic analysis based on the complete envelope gene classified DENV-3 isolates into five genotypes (Figure 1), which was confirmed by the Bayesian method (Additional file 1: Figure S1). Phylogenetic tree based on the complete sequence of coding region of DENV-3 genome showed the same genotype classification (Figure 2). The newly isolated DENV-3 strains belong to the genotype III, clustering with other DENV-3 isolates circulating in China in 2009 and in India in 2007 and 2008 (Figure 1). Interestingly, three additional DENV-3 strains isolated in Guangzhou in 2009 (09/GZ/1081, 09GZ/1483 and 09/GZ/10806) [27] belong to genotype V (Figure 1 & Additional file 1: Figure S1), which indicated that two genotypes of DENV-3 were co-circulating in Guangdong, 2009.
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-125/MediaObjects/12985_2011_Article_1812_Fig1_HTML.jpg
Figure 1

Phylogenetic tree based on the complete envelope gene from 58 DENV-3 strains sampled globally. The evolutionary history was inferred using the neighbor-joining method with MEGA 5 software [24]. Each strain is abbreviated with strain name and country of origin followed by the year of isolation. Bootstrap values greater than 0.9 based on 1000 replicates are shown for key nodes. The tree was rooted using DENV-1 strain Nauru, DENV-2 strain New Guinea C and DENV-4 strain B5 as outgroups. The newly DENV-3 isolates in the study are marked with red squares and other Chinese DENV-3 isolates taken for comparison are marked with blue squares.

https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-9-125/MediaObjects/12985_2011_Article_1812_Fig2_HTML.jpg
Figure 2

Phylogenetic tree based on complete sequences of coding region of viral genome from 44 DENV-3 strains sampled globally. The evolutionary history was inferred using the neighbor-joining method with MEGA 5 software [24]. Bootstrap values greater than 0.9 based on 1000 replicates are shown for key nodes. The tree was rooted using DENV-1 strain Nauru, DENV-2 strain New Guinea C and DENV-4 strain B5 as outgroups. The newly DENV-3 isolates in the study are marked with red squares and other Chinese DENV-3 isolates taken for comparison are marked with blue squares.

Discussion

In the present study, a family cluster of DENV-3 infections in Guangzhou, China was described. Three family members were diagnosed as DF, and all recovered finally. All the three family members recalled mosquito biting before illness, and none of them went aboard or on trip recently. Although family cluster of vector-borne diseases have been intensively described [28, 29], information regarding DF family cluster is limited. There is no doubt that any cluster of cases is of great concern and should be thoroughly investigated. Dengue can cause both the large epidemics and sporadic infections. The recognition of clustering of disease is important for medical providers and public health personnel in treating and controlling the disease, because multiple infections can occur simultaneously or following an index case. In this study, strict mosquito control measures were initiated immediately after confirmation of the DF cases, and no further cases were reported nearby thereafter.

Whether dengue is endemic in Guangdong remains disputable. Most dengue epidemics in Guangdong were initiated by the introduction of virus from imported cases [13, 18, 19, 27, 30], however, in this study none of the family member travelled aboard. Further epidemiology investigation also did not identify imported case nearby either. The origin of these DENV-3 isolate is really interesting. Since DENV-1 has circulated in Guangzhou for about ten years, the new DENV-3 has potential to increase the rate of secondary heterotypic infection. Furthermore, the previous studies showed that epidemic DHF has appeared in association with DENV-3 [3133]. In the Americas, DENV-3 presented greater epidemic potential and virulence [20]. Whatever, the emerging DENV-3 in Guangzhou might represent a risk factor for severe dengue illness, careful investigation and surveillance should be warranted in the future.

Most importantly, phylogenetic analysis demonstrated that at least two different genotypes of DENV-3 were co-circulated in Guangdong, China in 2009, which partly agree with the findings of the previous study [27]. Five genotypes of DENV-3 have been reported [20, 34]. The newly isolates in Guangdong form a distinct cluster with other Chinese isolates sampled from Zhejiang province in 2009 [35]. All these genotype III DENV-3 strains were closely related to those sampled in India in 2007 and 2008, suggesting these Chinese isolates might be imported from India. Previously, the introduction of new genotype III of DENV-3 has been recognized as one of the factors leading to the emergence of DHF in Pakistan and India [33, 36]. These strains are therefore interesting and their virological characterization and virulence analyses are currently underway.

However, three additional DENV-3 strains (09/GZ/1081, 09GZ/1483, and 09/GZ/10806), belonging to genotype V, were also identified in Guangzhou, 2009 in a separate study [27]. In addition, two strains (07CSHL001 and DTID-ZJU04) sampled from China, were grouped within genotype II. The origin of these isolates is difficult to determine without further information. The situation that multiple genotypes of DENV-3 co-circulated in Guangzhou, China deserves close concern and careful investigation.

Notes

Declarations

Acknowledgments

This study was supported in part by the National Natural Science Foundation of China (No.30972613 and No.81101243), the National 973 Project of China (No.2012CB518904) and the 39th Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry. CFQ was supported by Beijing Nova Program of Science and Technology (No.2010B041).

Authors’ Affiliations

(1)
State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology
(2)
Guangzhou No.8 People’s Hospital, Guangzhou Medical College
(3)
The Third People’s Hospital of Huizhou, The Third People’s Hospital of Huizhou

References

  1. Impact of Dengue. http://www.who.int/csr/disease/dengue/impact/en/
  2. Weaver SC, Reisen WK: Present and future arboviral threats. Antiviral Res 2010, 85: 328-345. 10.1016/j.antiviral.2009.10.008PubMedPubMed CentralView Article
  3. Fried JR, Gibbons RV, Kalayanarooj S, Thomas SJ, Srikiatkhachorn A, Yoon IK, Jarman RG, Green S, Rothman AL, Cummings DA: Serotype-specific differences in the risk of dengue hemorrhagic fever: an analysis of data collected in Bangkok, Thailand from 1994 to 2006. PLoSNegl Trop Dis 2010, 4: e617. 10.1371/journal.pntd.0000617View Article
  4. Halstead SB: Neutralization and antibody-dependent enhancement of dengue viruses. Adv Virus Res 2003, 60: 421-467.PubMedView Article
  5. Saito M, Oishi K, Inoue S, Dimaano EM, Alera MT, Robles AM, Estrella BD, Kumatori A, Moji K, Alonzo MT, et al.: Association of increased platelet-associated immunoglobulins with thrombocytopenia and the severity of disease in secondary dengue virus infections. ClinExpImmunol 2004, 138: 299-303.
  6. Dejnirattisai W, Jumnainsong A, Onsirisakul N, Fitton P, Vasanawathana S, Limpitikul W, Puttikhunt C, Edwards C, Duangchinda T, Supasa S, et al.: Cross-reacting antibodies enhance dengue virus infection in humans. Science 2010, 328: 745-748. 10.1126/science.1185181PubMedView Article
  7. Endy TP, Nisalak A, Chunsuttitwat S, Vaughn DW, Green S, Ennis FA, Rothman AL, Libraty DH: Relationship of preexisting dengue virus (DV) neutralizing antibody levels to viremia and severity of disease in a prospective cohort study of DV infection in Thailand. J Infect Dis 2004, 189: 990-1000. 10.1086/382280PubMedView Article
  8. Goncalvez AP, Engle RE, St Claire M, Purcell RH, Lai CJ: Monoclonal antibody-mediated enhancement of dengue virus infection in vitro and in vivo and strategies for prevention. ProcNatlAcadSci U S A 2007, 104: 9422-9427. 10.1073/pnas.0703498104View Article
  9. Wu JY, Lun ZR, James AA, Chen XG: Dengue Fever in mainland China. AmJTrop Med Hyg 2010, 83: 664-671.View Article
  10. Wu W, Bai Z, Zhou H, Tu Z, Fang M, Tang B, Liu J, Liu L, Chen W: Molecular epidemiology of dengue viruses in southern China from 1978 to 2006. Virol J 2011, 8: 322. 10.1186/1743-422X-8-322PubMedPubMed CentralView Article
  11. Qiu FX, Gubler DJ, Liu JC, Chen QQ: Dengue in China: a clinical review. Bull World Health Organ 1993, 71: 349-359.PubMedPubMed Central
  12. Li FS, Yang FR, Song JC, Gao H, Tang JQ, Zou CH, Hu BN, Wen SR, Qiu FX: Etiologic and serologic investigations of the 1980 epidemic of dengue fever on Hainan Island, China. AmJTrop Med Hyg 1986, 35: 1051-1054.
  13. He JF, Luo HM, Liang WJ, Zheng K, Min K, Liu LP: Epidemic situation of dengue fever outbreak in Guangdong province, China, 1990–2005. Dengue Bull 2007, 31: 1-9.
  14. Wang Q, Xu Z, Dou FM, Zhou H, Wang XF, Yin WW, Li Q: Current situation and surveillance on dengue fever in China, 2005–2007. Zhonghua Liu Xing Bing XueZaZhi 2009, 30: 802-806.
  15. Bharaj P, Chahar HS, Pandey A, Diddi K, Dar L, Guleria R, Kabra SK, Broor S: Concurrent infections by all four dengue virus serotypes during an outbreak of dengue in 2006 in Delhi. India. Virol J 2008, 5: 1.PubMedView Article
  16. Holmes EC, Tio PH, Perera D, Muhi J, Cardosa J: Importation and co-circulation of multiple serotypes of dengue virus in Sarawak, Malaysia. Virus Res 2009, 143: 1-5. 10.1016/j.virusres.2009.02.020PubMedView Article
  17. Lorono-Pino MA, Cropp CB, Farfan JA, Vorndam AV, Rodriguez-Angulo EM, Rosado-Paredes EP, Flores-Flores LF, Beaty BJ, Gubler DJ: Common occurrence of concurrent infections by multiple dengue virus serotypes. AmJTrop Med Hyg 1999, 61: 725-730.
  18. Chen S: The origin of dengue viruses caused the DF outbreak in Guangdong province, China, in 2006. Infect Genet Evol 2011, 11: 1183-1187. 10.1016/j.meegid.2011.03.025PubMedView Article
  19. Zheng K, Zhou HQ, Yan J, Ke CW, Maeda A, Maeda J, Takashima I, Kurane I, Ma H, Xie XM: Molecular characterization of the E gene of dengue virus type 1 isolated in Guangdong province, China, in 2006. Epidemiol Infect 2009, 137: 73-78. 10.1017/S0950268808000617PubMedView Article
  20. Lanciotti RS, Lewis JG, Gubler DJ, Trent DW: Molecular evolution and epidemiology of dengue-3 viruses. J Gen Virol 1994,75(Pt 1):65-75.PubMedView Article
  21. Deng YQ, Dai JX, Ji GH, Jiang T, Wang HJ, Yang HO, Tan WL, Liu R, Yu M, Ge BX, et al.: A broadly flavivirus cross-neutralizing monoclonal antibody that recognizes a novel epitope within the fusion loop of E protein. PLoS One 2011, 6: e16059. 10.1371/journal.pone.0016059PubMedPubMed CentralView Article
  22. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, et al.: Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23: 2947-2948. 10.1093/bioinformatics/btm404PubMedView Article
  23. Drummond AJ, Rambaut A: BEAST: Bayesian evolutionary analysis by sampling trees. BMC EvolBiol 2007, 7: 214. 10.1186/1471-2148-7-214View Article
  24. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. MolBiolEvol 2011, 28: 2731-2739.
  25. Saitou N, Nei M: The neighbor-joining method: a new method for reconstructing phylogenetic trees. MolBiolEvol 1987, 4: 406-425.
  26. WHO: Dengue - Guidelines for diagnosis, treatment, prevention and control. 2009. http://www.who.int/entity/tdr/publications/documents/dengue-diagnosis.pdf
  27. Di B, Bai ZJ, Wang YL, Luo L, Chen Y, Jiang LY, Yang ZC, Wang M: Molecular epidemiologic analysis on new emerged type 3 dengue virus in Guangzhou in 2009. Zhonghua Liu Xing Bing XueZaZhi 2010, 31: 804-807.
  28. Papa A, Bino S, Llagami A, Brahimaj B, Papadimitriou E, Pavlidou V, Velo E, Cahani G, Hajdini M, Pilaca A, et al.: Crimean-Congo hemorrhagic fever in Albania, 2001. Eur J ClinMicrobiol Infect Dis 2002, 21: 603-606. 10.1007/s10096-002-0770-9View Article
  29. Jones TF, Craig AS, Paddock CD, McKechnie DB, Childs JE, Zaki SR, Schaffner W: Family cluster of Rocky Mountain spotted fever. Clin Infect Dis 1999, 28: 853-859. 10.1086/515213PubMedView Article
  30. Yang F, Ma SQ, He JF, Mai ZJ, Liang WJ, Cai MX, Luo HM: Epidemiological analysis of imported cases of dengue fever in Guangdong province and Hong Kong during 2004–2006 in China. Zhonghua Liu Xing Bing XueZaZhi 2009, 30: 42-44.
  31. Briseno-Garcia B, Gomez-Dantes H, Argott-Ramirez E, Montesano R, Vazquez-Martinez AL, Ibanez-Bernal S, Madrigal-Ayala G, Ruiz-Matus C, Flisser A, Tapia-Conyer R: Potential risk for dengue hemorrhagic fever: the isolation of serotype dengue-3 in Mexico. Emerg Infect Dis 1996, 2: 133-135. 10.3201/eid0202.960210PubMedPubMed CentralView Article
  32. Messer WB, Gubler DJ, Harris E, Sivananthan K, de Silva AM: Emergence and global spread of a dengue serotype 3, subtype III virus. Emerg Infect Dis 2003, 9: 800-809. 10.3201/eid0907.030038PubMedPubMed CentralView Article
  33. Sharma S, Dash PK, Agarwal S, Shukla J, Parida MM, Rao PV: Comparative complete genome analysis of dengue virus type 3 circulating in India between 2003 and 2008. J Gen Virol 2011, 92: 1595-1600. 10.1099/vir.0.030437-0PubMedView Article
  34. Wittke V, Robb TE, Thu HM, Nisalak A, Nimmannitya S, Kalayanrooj S, Vaughn DW, Endy TP, Holmes EC, Aaskov JG: Extinction and rapid emergence of strains of dengue 3 virus during an interepidemic period. Virology 2002, 301: 148-156. 10.1006/viro.2002.1549PubMedView Article
  35. Sun J, Lin J, Yan J, Fan W, Lu L, Lv H, Hou J, Ling F, Fu T, Chen Z, et al.: Dengue virus serotype 3 subtype III, Zhejiang Province, China. Emerg Infect Dis 2011, 17: 321-323. 10.3201/eid1702.100396PubMedPubMed CentralView Article
  36. Khan E, Hasan R, Mehraj V, Nasir A, Siddiqui J, Hewson R: Co-circulations of two genotypes of dengue virus in 2006 out-break of dengue hemorrhagic fever in Karachi, Pakistan. J ClinVirol 2008, 43: 176-179.

Copyright

© Jiang et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement