Open Access

Cloning of full genome sequence of hepatitis E virus of Shanghai swine isolate using RACE method

  • Quan Shen1, 2,
  • Wen Zhang1,
  • Xiangrong Cao2,
  • Jing Mou1,
  • Li Cui1 and
  • Xiuguo Hua1Email author
Virology Journal20074:98

DOI: 10.1186/1743-422X-4-98

Received: 02 August 2007

Accepted: 09 October 2007

Published: 09 October 2007

Abstract

Genotype 4 hepatitis E virus (HEV) was reportedly transmitted freely between humans and swine in eastern China. The full-length genomic sequence of Shanghai swine isolate (SH-SW-zs1) recovered from feces sample of a pig which was infected with HEV RNA positive swine serum was determined using RT-PCR and RACE (Rapid Amplification of cDNA Ends) methods. The full genome of the SH-SW-zs1 isolate was 7265 nucleotides in length and phylogenetic analysis indicated that this isolate belonged to genotype 4. Comparison of the 3' UTR sequence with the corresponding regions of other 38 HEV strains from different region revealed that the Shanghai swine isolate is 21–49 bp longer than the other stains.

Introduction

Hepatitis E is an important public health disease in many developing countries of Asia and Africa and also occurs sporadically in some industrialized countries [14]. The disease mainly affects young adults and has a relatively high mortality of up to 25% in affected pregnant women [1]. The main mode of transmission of hepatitis E virus (HEV) is fecal-oral route, primarily through contaminated water supplies [1]. HEV is single-stranded, positive-sense RNA virus without an envelope [5]. The genome of HEV is approximately 7.2 Kb and consists three open reading frames (ORF1–3) [6]. ORF1 locates at the 5 ' end of genome and encodes non-structural proteins, including the methyltransferase, protease, helicase and RNA-dependent RNA polymerase (RdRp) [7]. ORF2 maps to the 3 ' terminus and encodes for a major structural protein, and ORF3 overlaps both and encodes a thus far unknown function [6]. Based on sequence analysis, HEV sequences have been classified into four major genotypes (1–4). Genotype 1 is the main cause of hepatitis E in developing countries in Asia and Africa, and genotype 2 has been documented in Mexico and Nigeria. Genotype 3 or 4 have been described in the United States, European countries, China, Taiwan, and Japan [8, 9]. The virus is also prevalent in swine, and isolates from swine are genetically closely related to that from humans [1012]. Lots of researches showed that genotype 4 and genotype 1 were the major genotype in China, recently genotype 3 HEV was reported in swine of Shanghai suburb [13]. For the further research, such as genomic characteristics and phylogenetic analysis, the full genome of the isolate which was proved prevalent in Shanghai swine was determined in the current study.

Materials and methods

Samples

132 serum samples of swine were collected from Shanghai suburb in China. These samples were tested for HEV RNA, using reverse transcriptase-polymerase chain reaction (RT-PCR). One HEV RNA positive swine serum sample was used for experimental infection of pigs [14]. HEV RNA positive swine fecal samples were stored as 10% suspension in aliquots at 70°C. About 10 g of HEV RNA positive fecal sample was converted to 10% (w/v) suspensions in PBS (0.01 M, pH 7.2–7.4, added 0.1% DEPC) for determining the full genomic sequence of HEV.

Viral RNA extraction

One hundred microlitre of fecal suspensions was mixed with 1 ml of trizol (invitrogen, USA). The mixture was homogenized and incubated for 5 min at room temperature. Two hundred microlitre of chloroform was added and the mixture was vigorously shaken for 15 s and incubated at room temperature for 3 min. The aqueous phase was transferred to a fresh microfuge tube after centrifugation at 12 000 g for 15 min at 4°C. Five hundred microlitre of isopropyl was added and the mixture was incubated for 15 min at room temperatures. Then centrifuging at 12 000 g at 4°C for 15 min. After discarding the supernatant, RNA pellet was washed with 1 ml 75% ethanol. The RNA pellet was Dried at room temperature for 5 min after centrifuging at 5 000 g for 5 min at 4°C and Discarding the supernatant. RNA sample was dissolved with 20 ul DEPC-treated water and used to reverse transcription immediately.

PCR amplification

Full-length primers: 18 sets of degenerate primers were designed based on a multiple sequence alignment of entire genome from isolates AY594199, DQ279091, DQ450072 and AB108537 (table 1). Reverse transcription was carried out at 42°C for 1 h with 1 ul (200 units) of AMV Reverse Transcriptase (TakaRa, Japan) and 1 ul (25 mM) of external antisense primer. The first round PCR was carried using 10 ul of the synthesized cDNA and an external set of forward and reverse primers with Ex Taq DNA polymerase (TakaRa, Japan). A nested PCR was carried out with internal primer set and 5 ul of the first PCR product. The PCR parameters of all amplification reactions included an initial incubation at 95°C for 9 min, followed by 39 cycles of denaturation at 94°C for 1 min, annealing for 1 min at a temperature varied according to the Tm of different primers, and extension at 72°C for 1.5 min, with a final incubation at 72°C for 7 min. The resulting PCR products were excised from agarose gel and purified using the Axyprep DNA Gel Extraction Kit (AXYGEN, USA). The purified PCR products were ligated into PMD18-T vector (TakaRa, Japan) using T4 DNA ligase (TakaRa, Japan) at 16°C overnight. The recombinant plasmid was transformed into DH5α competent Escherichia coli cells (TakaRa, Japan). Plasmids containing the insert fragment were identified by PCR. Three of the positive clones were sequenced.

Table 1

Primer name

Nucleotide position

Nucleotide sequence (5'-3')

HE0ES

104-84

CGGAGTTGGCCGCTGCTAGAG

HE0EA

482–501

TGTACT(G)TTTGCTGCTGAGAC

HE0IS

225-203

ATTGGGTGATTCCACAG(A)AACCTC

HE0IA

236–256

ATCCACAAC(T)GAGCTT(C)GAGCAG

HE1ES

11–32

TATGTGGTCGACGCCATGGAGG

HE1EA

528-509

GCCCTTTATTCACTGCACGA

HE1IA

573-554

ATACCGTGGCGAGCCATTGC

HE2ES

482–501

TGTACTTTTGCTGCTGAGAC

HE2EA

956–975

ACAGGGACGGCATGAAATGT

HE2IS

437–454

CTTCCACCTGT(C)T(C)GAT(C)CGG

HE2IA

1000-983s

AAGCATA(G)AGCCTGTCCCA

HE3ES

671–692

CGTGCA(T)GTG(A)ATTACATAT(C)GAGG

HE3EA

1336-1317

CCACCGG(T)CGAA(G)CACTGG(A)GCAT

HE3IS

742–762

GATCCGT(G)ACC(G)ACT(C)AAGGTCAC

HE3IA

1314-1293

AACTG(C)CAA(G)CTGA(G)CGA(G)CCAGGGA

HE4ES

984–1005

GGGACAGGCTTATGCTTTTTGG

HE4EA

1528-1508

TGCCTCATTATCATAACCCTG

HE4IS

956-975

ACGTTTCATGCCGTCCTGT

HE4IA

1703-1684

GGCCGTCG(A)GCA(G)TCAGAG(A)ACC(T)

HE5ES

1331-1348

CGGTGGT(C)TG(A)TCTGCC(T)GGC

HE5EA

1792-1746

GTTGAG(A)AAGGTT(C)TTATTG(A)

HE5IS

1310–1329

C(G)AGTTT(C)TATGCCCAGTGTCG

HE5IA

1803-1785

GACAG(A)C(G)ACATAC(T)TGCTCT(C)G

HE6ES

1508–1528

CAGGGT(C)TATGAT(C)AAT(C)GAGGC

HE6EA

2529-2510

GGGAAC(A)CGT(C)TGA(G)TAGAAT(A)GC

HE6IS

1679–1700

GTTGAG(A)GTC(T)TCTGAT(C)GCC(T)GACG

HE6IA

2477-2457

GGTTA(G)GAT(C)GCATTA(G)ACCAGCC

HE7ES

2028–2048

TGTGGTAC(T)T(C)AC(T)CCTGAGGGGC

HE7EA

2144-2123

CTCTACACT(C)CGG(T)ACCTGGTCGG

HE7IS*

2830–2850

GTAAGGGCTGGAAGGGTGGGC

HE7IA*

2913-2893

ACTTCAGTGGCGGAGTCTAAC

HE8ES

2753–2772

GCCTGGGAACGTAACCACCG

HE8EA

3366-3347

GTCTGGATC(T)TTT(C)GGGTACGC

HE8IS

2714–2733

GCCGGC(T)ATATATAAGGTC(A)CC

HE8IA

3438-3416

GCCTGGGTG(A)AAT(C)ACCAA(G)CTTCT(C)G

HE9ES

3209–3228

GGTGAC(T)CCC(T)AAT(C)AAT(C)AAATCCC

HE9EA

3948-3929

GGCGCTGCCATACGGCAGTG

HE9IS

3312–3334

GATGC(T)CCGGCG(A)GAT(C)GTCTGTGAG

HE9IA

3810-3791

GGTCGA(G)TGGCCAAGC(T)TCCTC

HE10ES

3764–3781

CAGTTTAGTGCT(C)TAC(T)CAG

HE10EA

4432-4413

ATCATTCTCAAAAACCTTAC

HE10IS

3587–3605

ACG(T)GAGAAG(A)TGTGTGGTG(C)G

HE10IA

4518-4496

CACTCC(T)TCCATGATTATACACTC

HE11ES

4290–4311

TGTTC(T)GGCCCA(C)TGGTTT(C)CGCGC

HE11EA

4752-4733

CGATAGTCACTACAGAGCAC

HE11IS

4355–4375

TATGGTGATGCA(G)TATGAG(A)GAC

HE11IA

4736-4717

GCACAACAGAATCATCTCCC

HE12ES

4607–4625

TGGAAGAAA(G)CAT(C)TCTGGTG

HE12EA

5253-5233

CCGGTGGCGCGGGCAGCATAG

HE12IS

4496–4518

GAGTGTATAATCATGGAG(A)GAGTG

HE12IA

5347–5366

GGTTGGATGAATATAGGGGA

HE13ES

4977-4997

CGAATGTGGCTCAGGTTTGTG

HE13EA

5451-5431

GCCAAGCGGAACCGAGTGGAC

HE13IS

5020–5039

CGGTGTTAGCCCTGGCTTGG

HE13IA

5392-5371

GTTGGAATGTCGGATGCGAAGG

HE14ES

5347–5366

TCCCCTATATTCATCCAACC

HE14EA

5956-5934

TGATTG(T)CGATAG(A)TGCAGGCGCTC

HE14IS

5233–5252

CTATGCTGCCCGCGCCACCG

HE14IA

5980-5957

GAGGTCTCAACT(C)GAG(A)CGCCAA(G)CCC

HE15ES

5922–5942

GTGATT(C)CCTAGT(C)GAGCGCCTG

HE15EA

6415-6397

GTCGGCTCGCCATTGGCTG

HE15IS

5877–5896

ACTGATGTCCGC(G)ATC(T)CTTGT

HE15IA

6453-6433

CCTGCTGAGCATTCTCGACTG

HE16ES

6336–6357

CTC(A)CCGACAGAATTGATTTCGT

HE16EA

7005-6985

CAGAG(A)TGA(G)GGT(G)GCA(G)AGGACAC

HE16IS

6271–6292

TTGGTGAG(A)GTT(C)GGC(T)CGTGGTAT

HE16IA

7074-7054

CAGGGCAA(G)AG(A)ATCATCG(A)AAAG

HE17ES*

6763–6782

CGCTCACTACTATCCAGCAG

HE17IS*

6787–6808

CTAAGACCTTCTTTGTTCTGCC

HE17A

 

GTTTTCCCAGTCACGACTTTTTTTTTTTTTTT

*: the primers were designed according to isolate in this study.

  

Position and nucleotide sequence of oligonucleotide primers for PCR. The nucleotide position is in accordance with the SH-SW-zs1 isolate in this study. In the primer name, ES, EA, IS and IA mean "external sense", "external antisense", "internal sense" and "internal antisense", respectively. Letters in parentheses indicate degenerate bases.

5'RACE

The 5'RACE was carried out with the 5-Full RACE Core Set (TaKaRa, Japan) kit following the manufacture's instructions. Briefly, 1st strand cDNA was Synthesized by reverse transcription using 5'end-phosphorylated RT Primer which was specific to the swine HEV (5'-p-GTCATRCCRTGGCG-3'). The PCR reaction mixture was incubated for 2 min at 94°C followed by 35 amplification cycles, comprising denaturation at 94°C for 30 s, annealing at 65°C for 30 s and extension at 72°C for 30 s. The reaction was extended for another 7 min at 72°C to insure the full extension. Fifteen ul of 1st Strand cDNA was treated with RNase H in a total 75 μl reaction mixture containing 15 ul of Hybrid RNA Degeneration Buffer for 1 h at 30°C. The mixture was then precipitated at -20°C for 30 min, being added 100 ul of H2O and 500 ul 100% ethanol. The supernatant was discarded and the pellet was washed with 75% ethanol after centrifuging at 12 000 g for 5 min. The pellet was dissolved with 8 ul of RNA (ssDNA) Ligation Buffer and 12 ul of H2O after dried at room temperature for 5 min. 20 ul of 40% PEG-6000 and 1 ul of ligase were added and incubated at 16°C overnight. Fifteen microliters of circled cDNA was then used as template for nested PCR using ExTaq DNA polymerase (TaKaRa, Japan)with two sets of primers: 5'-CGGAGTTGGCCGCTGCTAGAG-3'(external forward primer, nucleotide position numbers 104 to 84), 5'-TGTACT(G)TTTGCTGCTGAGAC-3'(external reverse primer, nucleotide position numbers 482 to 501), 5'-ATTGGGTGATTCCACAG(A)AACCTC-3'(internal forward primer, nucleotide position numbers 225 to 203), and 5'-ATCCACAAC(T)GAGCTT(C)GAGCAG-3'(internal reverse primer, nucleotide position numbers 236 to 256). The PCR reaction mixture was incubated for 2 min at 94°C followed by 35 amplification cycles, comprising denaturation at 94°C for 30 s, annealing at 65°C for 30 s and extension at 72°C for 30 s. The reaction was extended for another 7 min at 72°C to insure the full extension. The final PCR product was analyzed on 20 g/L agarose gel.

3'RACE

The 3'RACE was carried out with the TaKaRa RNA PCR Kit (TaKaRa, japan) following the manufacture's instructions. Brifely, ten microliters of the HEV RNA was used as template to synthesize cDNA with AMV Reverse transcriptase for 1 h at 42°C. The external reverse primer (HE17A) which has a poly (T) tract was used to prime the cDNA synthesis. The cDNA was then amplified by nested PCR with the external forward primer (5'-CGCTCACTACTATCCAGCAG-3', nucleotide position numbers 6763–6782) and internal forward primer (5'-CTAAGACCTTCTTTGTTCTGCC-3', nucleotide position numbers 6787–6808) with ExTaq DNA polymerase (TaKaRa, Japan). The PCR reaction mixture was incubated for 2 min at 94°C, followed by 35 amplification cycles comprising denaturation at 94°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 30 s. The reaction was extended for another 7 min at 72°C to ensure the full extension.

Phylogenetic analysis

Using Clustal × 1.8, multiple alignments of nucleotide sequences was carried out. The phylogenetic status SH-SW-zs1 isolate was assessed employing the software MEGA Version 2.1[15]. For analysis in MEGA, Jukescantor (JC) distance was utilized employing the Neighbor joining (NJ) algorithm. The reliability of different phylogenetic groupings was evaluated by using the bootstrap test (1000 bootstrap replication) available in MEGA. Accession numbers, designations and countries of origin of the full genome sequences employed for analysis in the present study were as follows:

Genotype 1: AF051830, Nepal; X99441, India; AF076239, India; AF459438, India; D10330, Burma; M73218, Burma; AF185822, Pakistan; X98292, India; L25595, China; M80581, Pakistan; AY230202, Morocco.

Genotype 2: M74506, Mexico.

Genotype 3: AP003430, Japan, human; AB091394, Japan, human; AB073912, Japan, swine; AY115488, Canada, swine; AF060668, US, human; AF082843, US, swine; AB089824, Japan, human; AB074918, Japan, human; AB074920, Japan, human.

Genotype 4: AB091395, Japan, human; AB097812, Japan, human; AB097811, Japan, swine; AB074915, Japan, human; AB074917, Japan, human; AJ272108, China, human; AB108537, China, human; AB161717, Japan, human; AB161718, Japan, human; AB161719, human; DQ450072, China, swine; AY594199, China, swine; DQ279091, China, swine; AB197673, China, human; EF077630, China, swine; AB197674, human.

Avian Hepatitis E virus (AY535004) was chosen as an out-group. The sequence reported here has been deposited with GenBank accession no.: EF570133.

Results

3'RACE

As shown in Figure 1, 3'RACE band of the expected size was obtained. The 3' terminus of this study had 93 nucleotides upstream of the polyA. The sequence of 3'UTR was: TTT ATT CTT CTT GTA CCT CCC CTT CGG TTC TGT TTC TTT TTA TTT CTC CTT TCT GCG TTC CGC GCT CAC TAC TAT CCA GCA GGA TCC ATG TTG. Comparison of the 3'UTR sequence with the corresponding regions of other 38 HEV strains from different region of the world revealed that the Shanghai swine isolate is 21–49 bp longer than all the other stains (additional file).
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-4-98/MediaObjects/12985_2007_Article_311_Fig1_HTML.jpg
Figure 1

RT-PCR products of SH-SW-zs1 isolate. The right side shows the primers and the expected length of the fragment; Arrows display the aimed bands.

Analysis of Full-Length Genome of Shanghai Isolate

The genomic length of the SH-SW-zs1 isolate was determined to be 7265 nucleotides (nt) excluding poly (A) tail at 3' terminus and contained three open reading frames (ORFs) similar to earlier reported human and swine HEV isolates. The genomic organization consisted of 5' untranslated region (5'UTR) of 25 nt (1–25), ORF-1 of 5127 nt (26–5152), ORF-2 of 1983 nt (5190–7172), ORF-3 of 372 nt (5249–5520) and 3'UTR of 93 nt (7173–7265), followed by a poly (A) tail of 26 residues. The length of 5'UTR was same as that of other type 4 isolates and had nucleotide G at the extreme 5' end of the genome as other reported genotype 4 sequences. Whole genome-based phylogenetic analysis confirmed classification of Shanghai swine in genotype 4 (Fig. 2). The phylogenetic tree showed that genotype 4 could be divided into 3 main subgroups. SH-SW-zs1 isolate closely clustered with isolate DQ450072 which was isolated from eastern China, and they shared 89.3% identity (with divergence of 11.3%) with each other and represented a distinct subgroup among the genotype 4 isolates with a bootstrap value of 100%.
https://static-content.springer.com/image/art%3A10.1186%2F1743-422X-4-98/MediaObjects/12985_2007_Article_311_Fig2_HTML.jpg
Figure 2

Phylogenetic trees constructed using MEGA software depicting genotypic status of SH-SW-zs1 on the basis of full-length genome sequence of 39 HEV isolates. Genbank accession numbers for the full genome were marked at each branch. Percent bootstrap support is indicated at each node. The abbreviations Ch and Ja stand for China and Japan, respectively.

Discussion

HEV is the major cause of enterically transmitted non-A, non-B, non-C hepatitis and is responsible for significant morbidity and mortality in developing countries [16]. Outbreaks of hepatitis E have been described in Asia, Africa and Mexico [1618], while sporadic cases have been reported in the United States, Japan and other developed countries [8]. It has been shown that HEV is a zoonotic virus [19, 20]. Hitherto, the lack of an efficient cell-culture system for HEV has greatly hampered detailed analysis of the virus replication cycle in infected cells, which makes it difficult to resolve many important questions. Meanwhile, cloning full-length genome of HEV is an efficient way to analysis molecular character, viral replication and other problems. Some reports indicated that genotype 4 and genotype 1 were the major genotype in China, though genotype 3 HEV was recently found in swine of Shanghai suburb [13]. Recent observations suggested that the HEV genotype influences the severity of hepatitis E, and that genotype 4 is associated more strongly with the severe form of hepatitis E than genotype 3 [21]. Therefore, the genomic full-length of the Shanghai isolate was determined in this study for further demonstrating the HEV strain prevalent in eastern China. The full genome of the SH-SW-zs1 isolate was 7265 nucleotides in length and phylogenetic analysis indicated that this isolate belonged to genotype 4. This isolate closely clustered with isolate DQ450072 and they shared 89.3% identity(with divergence of 11.3%) with each other and represented a distinct subgroup among the genotype 4 isolates with a bootstrap value of 100%, thus suggested that they may come from one common strain. Result of comparison showed that the 3'UTR of this Shanghai isolate was 21–49 bp longer than all the other stains so far avalible on-line. By blast the 21-nt-fragment in GenBank, we found it has many homologous sequences which shared more than 85% identity with it. So we presumed that this fragment may come from the recombination of genome HEV and its host or other microorganism. The true origin of this short fragment and its specific function need to be further studied.

Declarations

Acknowledgements

This study was supported by Key Project of Shanghai Science and Technology Committee of China. (No.06391912).

Authors’ Affiliations

(1)
School of Agriculture and Biology, 800 Dongchuan Road, Shanghai JiaoTong University
(2)
School of Life Science, 1 Wenyuan Road, Nanjing Normal University

References

  1. Emerson SU, Purcell RH: Hepatitis E virus[J]. Rev Med Virol 2003,13(3):145-154. 10.1002/rmv.384PubMedView ArticleGoogle Scholar
  2. Kabrane-Lazizi Y, Zhang M, Purcell RH, Miller KD, Davey RT, Emerson SU: Acute hepatitis caused by a novel strain of hepatitis E virus most closely related to United States strains. J Gen Virol 2001, 82: 1687-93.PubMedView ArticleGoogle Scholar
  3. Schlauder GG, Desai SM, Zanetti AR, Tassopoulos NC, Mushahwar IK: Novel hepatitis E virus (HEV) isolates from Europe: evidence for additional genotypes of HEV. J Med Virol 1999,57(3):243-51. 10.1002/(SICI)1096-9071(199903)57:3<243::AID-JMV6>3.0.CO;2-RPubMedView ArticleGoogle Scholar
  4. Takahashi M, Nishizawa T, Yoshikawa A, Sato S, Isoda N, Ido K, Sugano K, Okamoto H: Identification of two distinct genotypes of hepatitis E virus in a Japanese patient with acute hepatitis who had not travelled abroad. J Gen Virol 2002, 83: 1931-40.PubMedView ArticleGoogle Scholar
  5. Purcell RH, Emerson SU: Animal models of hepatitis A and E. ILAR J 2001,42(2):161-177.PubMedView ArticleGoogle Scholar
  6. Tam AW, Smith MM, Guerra ME, Huang CC, Bradley DW, Fry KE, Reyes GR: Hepatitis E virus (HEV): molecular cloning and sequencing of the full-length viral genome. Virology 1991,185(1):120-31. 10.1016/0042-6822(91)90760-9PubMedView ArticleGoogle Scholar
  7. Koonin EV, Gorbalenya AE, Purdy MA, Rozanov MN, Reyes GR, Bradley DW: Computer-assisted assignment of functional domains in the nonstructural polyprotein of hepatitis E virus: delineation of an additional group of positive-strand RNA plant and animal viruses. Proc Natl Acad Sci USA 1992, 89: 8259-63. 10.1073/pnas.89.17.8259PubMedPubMed CentralView ArticleGoogle Scholar
  8. Schlauder GG, Mushahwar IK: Genetic heterogeneity of hepatitis E virus. J Med Virol 2001,65(2):282-292. 10.1002/jmv.2031PubMedView ArticleGoogle Scholar
  9. Mizuo H, Suzuki K, Takikawa Y, Sugai Y, Tokita H, Akahane Y, Itoh K, Gotanda Y, Takahashi M, Nishizawa T, Okamoto H: Polyphyletic strains of hepatitis E virus are responsible for sporadic cases of acute hepatitis in Japan. J Clin Microbiol 2002, 40: 3209-3218. 10.1128/JCM.40.9.3209-3218.2002PubMedPubMed CentralView ArticleGoogle Scholar
  10. Drobeniuc J, Favorov MO, Shapiro CN, Bell BP, Mast EE, Dadu A, Culver D, Iarovoi P, Robertson BH, Margolis HS: Hepatitis E virus antibody prevalence among persons who work with swine. J Infect Dis 2001, 184: 1594-1597. 10.1086/324566PubMedView ArticleGoogle Scholar
  11. Lu L, Li C, Hagedorn CH: Phylogenetic analysis of global hepatitis E virus sequences: genetic diversity, subtypes and zoonosis. Rev Med Virol 2006, 16: 5-36. 10.1002/rmv.482PubMedView ArticleGoogle Scholar
  12. Zheng Y, Ge S, Zhang J, Guo Q, Ng MH, Wang F, Xia N, Jiang Q: Swine as a principal reservoir of hepatitis E virus that infects humans in eastern China. J Infect Dis 2006, 193: 1643-1649. 10.1086/504293PubMedView ArticleGoogle Scholar
  13. Ning H, Niu Z, Yu R, Zhang P, Dong S, Li Z: Identification of genotype 3 hepatitis E virus in fecal samples from a pig farm located in a Shanghai suburb. Vet Microbiol 2007, 121: 125-130. 10.1016/j.vetmic.2006.11.006PubMedView ArticleGoogle Scholar
  14. Arankalle VA, Chobe LP, Jha J, Chadha MS, Banerjee K, Favorov MO: Aetiology of acute sporadic non-A, non-B hepatitis in western India. J Med Virol 1993, 40: 121-125. 10.1002/jmv.1890400208PubMedView ArticleGoogle Scholar
  15. Kumar S, Tamura K, Nei M: MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Briefings in Bioinformatics 2004, 5: 150-163. 10.1093/bib/5.2.150PubMedView ArticleGoogle Scholar
  16. Harrison TJ: Hepatitis E virus-an update. Liver 1999, 19: 171-176. 10.1111/j.1478-3231.1999.tb00031.xPubMedView ArticleGoogle Scholar
  17. Arankalle VA, Chadha MS, Chitambar SD, Walimbe AM, Chobe LP, Gandhe SS: Changing epidemiology of hepatitis A and hepatitis E in urban and rural India (1982–98). J Viral Hepat 2001, 8: 293-303. 10.1046/j.1365-2893.2001.00290.xPubMedView ArticleGoogle Scholar
  18. van Cuyck-Gandre H, Caudill JD, Zhang HY, Longer CF, Molinie C, Roue R, Deloince R, Coursaget P, Mamouth NN, Buisson Y: Short report: polymerase chain reaction detection of hepatitis E virus in north African fecal samples. Am J Trop Med Hyg 1996, 54: 134-135.PubMedGoogle Scholar
  19. Clayson ET, Shrestha MP, Vaughn DW, Snitbhan R, Shrestha KB, Longer CF, Innis BL: Rates of hepatitis E virus infection and disease among adolescents and adults in Kathmandu, Nepal. J Infect Dis 1997, 176: 763-766.PubMedView ArticleGoogle Scholar
  20. Meng XJ, Purcell RH, Halbur PG, Lehman JR, Webb DM, Tsareva TS, Haynes JS, Thacker BJ, Emerson SU: A novel virus in swine is closely related to the human hepatitis E virus. Proc Natl Acad Sci USA 1997, 94: 9860-9865. 10.1073/pnas.94.18.9860PubMedPubMed CentralView ArticleGoogle Scholar
  21. Mizuo H, Yazaki Y, Sugawara K, Tsuda F, Takahashi M, Nishizawa T, Okamoto H: Possible risk factors for the transmission of hepatitis E virus and for the severe form of hepatitis E acquired locally in Hokkaido, Japan. J Med Virol 2005,76(3):341-349. 10.1002/jmv.20364PubMedView ArticleGoogle Scholar

Copyright

© Shen et al; licensee BioMed Central Ltd. 2007

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.