Table 1 Primers used for real-time RT-PCR
Gene | GenBank accession No | Function | Primer sequence (5′→ 3′ ) | Anneal Temp (°C) | Tm(°C) | Plate-reading Temp (°C) | Fragment (bp) |
|---|---|---|---|---|---|---|---|
SLA-2 (swine leukocyte antigen 2) | AF464005 | Presents peptides of endogenous proteins to CD8+ cytotoxic T cells and stimulates cellular immune response. | cgcacagactttccgagtg (F) | 60 | 85.9 | 83 | 110 (287–396) |
gtctggtcccaagtagcag (R) | |||||||
TAP1 (transporter associated with antigen processing 1) | DQ227989 | Transports efficient peptides into the ER for binding to MHC class I molecules. | ccgaacaccaatgtacctcc (F) | 60 | 86.8 | 84 | 235 (743–977) |
tccacctggcagtcatagac (R) | |||||||
SLA-DR (swine leukocyte antigen) | DQ883222 | Presents peptides of exogenous proteins to CD4+ helper T cells and regulates humoral response. | gtgtgcgacggaatctataac (F) | 60 | 86.8 | 83 | 258 (332–589) |
gagcatgagccctaagagac (R) | |||||||
Ii (invariant chain) | AB116558 | Promotes proper folding and assembly of class II α/β heterodimers, facilitates intracellular transport of class II molecules, and segregates MHC class II exogenous antigen presentation pathway from the MHC class I antigen presentation pathway. | gcaacgccaccaagtacgg (F) | 60 | 86.6 | 84 | 185 (332–516) |
aagagccactgacgcagcc (R) | |||||||
CD40 | AF248545 | Supplies a second antigen-independent signal (costimulation). Activates and regulates T cell immunity. | tcaagcagatggcgacagag (F) | 60 | 85.6 | 82 | 198 (392–589) |
caccagggctctcatccga (R) | |||||||
CD80 | AB026121 | Supplies a second antigen-independent signal (costimulation). Activates and regulates T cell immunity. | agcgggagagagggtcttat (F) | 60 | 83.0 | 79 | 123 (344–436) |
aagggcagtaatactaggcac (R) | |||||||
CD86 | L76099 | Supplies a second antigen-independent signal (costimulation). Activates and regulates T cell immunity. | gttcctatccaccagatgagt (F) | 60 | 81.6 | 78 | 257 (343–599) |
gaagagacaccctgattgatac(R) | |||||||
IFN-α | M28623 | Exerts potent antitumor, anti-viral, and immunomodulatory activities. | tgggagatcgtcagggcag (F) | 60 | 83.9 | 81 | 155 (603–757) |
tgacatggcagaacaggagg (R) | |||||||
IFN-β | EF104599 | Exerts potent antitumor, anti-viral, and immunomodulatory activities. | ggacagttgcctgggactc (F) | 60 | 82.1 | 79 | 128 (127–254) |
tggagcatctcgtggataatc (R) | |||||||
GAPDH (glyceraldehde-3-phosphate dehydrogenase) | AF017079 | Housekeeping gene used as an internal control in quantitative real-time PCR assays. | tggtgaaggtcggagtgaac (F) | 60 | 86.4 | 83 | 225 (343–567) |
ggaagatggtgatgggatttc (R) | |||||||
5′-UTR of CSFV genome | AF531433 | Regulates translation of the viral genomes. | gccatgcccatagtaggact (F) | 60 | 86.5 | 83 | 116 (97–212) |
gcttctgctcacgtcgaact (R) |