Screening and identification of cyprinid herpesvirus 2 (CyHV-2) ORF55-interacting proteins by phage display

Table 4 Enrichment, titer analysis and polypeptide screening of phages

Panning rounds	Target protein (µg/mL)	Tween-20 (V/V)	Washing times	Incubation time (min)
(A). Screening conditions for three rounds of panning
First round	100	0.1%	10	80
Second round	90	0.2%	12	60
Third round	85	0.5%	15	50

Panning rounds	Input phage	Recovered phage	Recovery
(B). Recovery of Ph.D.-12 library screening
First round	1.5 × 10¹²	2.9 × 10⁴	1.9 × 10^–8
Second round	1.8 × 10¹¹	1.3 × 10⁵	7.2 × 10^–7
Third round	3 × 10¹⁰	1.5 × 10⁵	5 × 10^–6

Nucleotide sequence	Repetition number	Translation
(C). Sequence analysis of specific binding peptide of ORF55 protein
CTTTCGCCTGGGGCTAATAGTCATGTTTCTCGGCAT	38	LSPGANSHVSRH

Protein name	Number of amino acids
(D). Prediction of interactional host genes
Gastrula zinc finger protein XlCGF8.2DB-like (ZFP)	371
WD repeat-containing protein 7 isoform X1 (WDR7)	1466
Actin-binding Rho-activating protein (ABRA)	157
Zinc finger protein 516-like Isoform X1 (ZFP516)	1065

A Screening conditions for three rounds of panning. During the three rounds of screening, the screening conditions were optimized by gradually reducing the amount of coated protein, increasing the concentration of Tween-20 and washing times, and reducing the incubation time with the phage to obtain positive clones with high affinity. B Recovery of Ph.D.-12 library screening. Phage titers were detected after each round of screening according to the manual M13 method. In each round of screening, input phage and recovered phage data were recorded, and recovery rate (%) was used to reflect the enrichment of specifically bound phages. C Sequence analysis of specific binding peptide of ORF55 protein. Fifty phage spots obtained in round 3 screening were randomly selected for DNA sequence determination. After translating the phage nucleic acid sequence into amino acids, the polypeptide sequence LSPGANSHVSRH had 38 repeats. D Prediction of Interactional host genes. The above polypeptide sequence and protein sequence alignment with the crucian carp library by NCBI were predicted to potentially interact with four crucian carp-related proteins.

ISSN: 1743-422X