Skip to main content

Table 1 Sequences of primers and probes

From: Development of a multiplex droplet digital PCR assay for detection of enterovirus, parechovirus, herpes simplex virus 1 and 2 simultaneously for diagnosis of viral CNS infections

Primer/probe Sequence (5′–3′) Concentration, nmol/L Refs.
Simplex ddPCR Quadruplex ddPCR
EV-fora GGTGTGAAGAGCCTATTGAGCT 400 400 In house
EV-revb GAAACACGGACACCCAAAGTAGT 400 400  
EV-probe FAM-TCCTCCGGCCCCTGAATGCGGCTAATCC-BHQ1 200 200  
HSV2-for CGCTCTCGTAAATGCTTCCCT 400 400 [23]
HSV2-rev TCTACCCACAACAGACCCACG 400 400  
HSV2-probe FAM-CGCGGAGACATTCGAGTACCAGATCG-BHQ1 100  
  VIC-CGCGGAGACATTCGAGTACCAGATCG-BHQ1 200 100  
HPeV-for GTGCCTCTGGGGCCAAAAG 400 400 [24]
HPeV-rev TCAGATCCATAGTGTCGCTTGTTAC 400 400  
HPeV-probe FAM-ACGGGTACCTTCTGGGCATCCTTCG-BHQ1 200 50  
  VIC-ACGGGTACCTTCTGGGCATCCTTCG-BHQ1 150  
HSV1-for CGGCCGTGTGACACTATCG 400 400 [23]
HSV1-rev CTCGTAAAATGGCCCCTCC 400 400  
HSV1-probe VIC-CCATACCGACCACACCGACGAAC-BHQ1 200 400  
  1. aForward primer
  2. bReverse primer