Skip to main content

Table 1 Primers for qRT-PCR

From: HBx inhibits DNA sensing signaling pathway via ubiquitination and autophagy of cGAS

Primer Sequence
cGAS Forward 5'AAGCTCCGGGCGGTTTTGGA 3'
cGAS Reverse 5'AGGTGCAGAAATCTTCACGTGCTC3'
STING Forward 5'GTGGCTTGAGGGGAACCCGC3'
STING Reverse 5'GGCTGGAGTGGGGCATCTTCT3'
IFN-β Forward 5'AGGACAGGATGAACTTTGAC3'
IFN-β Reverse 5'TGATAGACATTAGCCAGGAG3'
ISG56 Forward 5'TCTCAGAGGAGCCTGGCTAA3'
ISG56 Reverse 5'TGACATCTCAATTGCTCCAG 3'
ISG54 Forward 5'GGAGCAGATTCTGAGGCTTTGC3'
ISG54 Reverse 5'GGATGAGGCTTCCAGACTCCAA3'