Skip to main content

Table 1 The primer sequences in this study

From: Identification of equine herpesvirus 8 in donkey abortion: a case report

Primers Primer sequences (5'–3') PCR product sizes (bp)
EAV ORF7-F ATGGCGTCAAGACGATCAC 333
EAV ORF7-R TTACGGCCCTGCTGGAGGC
EHV-1 gB-F GAACCTCAGCCAACCCA 792
EHV-1gB-R GCACTTTGCGGACGAAC
EHV-4 gB-F CTTAATCGCATTTAGACCGATG 1591
EHV-4 gB-R CCGGAACTAGAAAGATGTTATGC
EHV-8 G1-F TCAGACTGTCACTCGTGGGA 316
EHV-8 G1-R CCTGGAGGCCGTTTAACACA