Skip to main content

Table 2 RNA interference sequences

From: IRF2 inhibits ZIKV replication by promoting FAM111A expression to enhance the host restriction effect of RFC3

siRNAs Sense (5′–3′) Antisense (5′–3′)
siNC UUCUCCGAACGUGUCACGUT ACGUGACACGUUCGGAGAATT
siIRF2 GCAAUCCGGUGCCUUACAAT UUGUAAGGCACCGGAUUGCTT
siFAM111A GGUCAAUGUGUAAGGG UCACCCUUACACAUUGACC
siRFC3 AAGUAACUACCACCUUGAA UAACUUCAAGGUGGUAGUUA