Skip to main content

Table 1 Real-time PCR primers

From: IRF2 inhibits ZIKV replication by promoting FAM111A expression to enhance the host restriction effect of RFC3

Gene name Forward primer (5′–3′) Reverse primer (5′–3′)
GAPDH GCCTCCTGCACCACCAACTG ACGCCTGCTTCACCACCTTC
IRF2 ATTTGCCAAGTTGTAGAGG CTATCAGTCGTTTCGCTTT
IFIT1 GCAGCCAAGTTTTACCGAAG GCCCTATCTGGTGATGCAGT
FAM111A CTTCACAAAAAGGGCGCAA ATCAACTGGCTGGGTGCTTT
RFC3 GCCTGCAGAGTGCAACAATA TCAAGGAGCCTTTGTGGAGT
ZIKV NS5 GCAGAGCAACGGATGGGAT ATGGTGGGAGCAAAACGGA
ISG15 CGCAGATCACCCAGAAGATT GCCCTTGTTATTCCTCACCA