Skip to main content

Table 1 Primers used in this study

From: The interactions of ZDHHC5/GOLGA7 with SARS-CoV-2 spike (S) protein and their effects on S protein’s subcellular localization, palmitoylation and pseudovirus entry

Name Sequence(5'to 3')a Usage
S-F2 CTAGCGTTTAAACTTAAGCTTATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGCGTGAACCTGACCACA (HindIII) pcDNA3.1-S-HA, pcDNA3.1-SC10A-HA/Co-IP, ABE
S-HA-R TGCTGGATATCTGCAGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTACATGGTGTAGTGCAGCTTCACGCC (EcoRI)
SA1235C-F TATCGTGATGGTGACCATCATGCTGTGCGCTATGACATCC pcDNA3.1-SA1235C-HA/ABE
SA1235C-R GGATGTCATAGCGCACAGCATGATGGTCACCATCACGATA
SA1236C-F TATCGTGATGGTGACCATCATGCTGGCCTGTATGACATCC pcDNA3.1-SA1236C-HA/ABE
SA1236C-R GGATGTCATACAGGCCAGCATGATGGTCACCATCACGATA
SA1240C-F CATCATGCTGGCCGCTATGACATCCTGCGCTTCTGCCCTG pcDNA3.1-SA1240C-HA/ABE
SA1240C-R CAGGGCAGAAGCGCAGGATGTCATAGCGGCCAGCATGATG
SA1241C-F CATCATGCTGGCCGCTATGACATCCGCCTGTTCTGCCCTG pcDNA3.1-SA1241C-HA/ABE
SA1241C-R CAGGGCAGAACAGGCGGATGTCATAGCGGCCAGCATGATG
SA1243C-F GCTGGCCGCTATGACATCCGCCGCTTCTTGCCTGAAGGGC pcDNA3.1-SA1243C-HA/ABE
SA1243C-R GCCCTTCAGGCAAGAAGCGGCGGATGTCATAGCGGCCAGC
SA1247C-F GACATCCGCCGCTTCTGCCCTGAAGGGCTGCGCTAGCGCT pcDNA3.1-SA1247C-HA/ABE
SA1247C-R AGCGCTAGCGCAGCCCTTCAGGGCAGAAGCGGCGGATGTC
SA1248C-F GACATCCGCCGCTTCTGCCCTGAAGGGCGCCTGTAGCGCT pcDNA3.1-SA1248C-HA/ABE
SA1248C-R AGCGCTACAGGCGCCCTTCAGGGCAGAAGCGGCGGATGTC
SA1250C-F TCTGCCCTGAAGGGCGCCGCTAGCTGTGGCTCCGCCGCTA pcDNA3.1-SA1250C-HA/ABE
SA1250C-R TAGCGGCGGAGCCACAGCTAGCGGCGCCCTTCAGGGCAGA
SA1253C-F TCTGCCCTGAAGGGCGCCGCTAGCGCTGGCTCCTGCGCTA pcDNA3.1-SA1253C-HA/ABE
SA1253C-R TAGCGCAGGAGCCAGCGCTAGCGGCGCCCTTCAGGGCAGA
SA1254C-F CTGAAGGGCGCCGCTAGCGCTGGCTCCGCCTGTAAGTTTG pcDNA3.1-SA1254C-HA/ABE
SA1254C-R CAAACTTACAGGCGGAGCCAGCGCTAGCGGCGCCCTTCAG
ZDHHC5-F CTTGGTACCGAGCTCGGATCCATGCCCGCAGAGTCTGGAAAG (BamHI) pcDNA3.1-ZDHHC5-3Flag/co-IP
ZDHHC5-3Flag-R TGCTGGATATCTGCAGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCCACCGAAATCTCATAGGTGG (EcoRI)
GOLGA7-F CTTGGTACCGAGCTCGGATCCATGAGGCCGCAGCAGGCGCC (BamHI) pcDNA3.1-GOLGA7-3Flag/co-IP
GOLGA7-3Flag-R TGCTGGATATCTGCAGAATTCTTACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCTCTTCCACTGCTCATGCCTC (EcoRI)
ZDHHC5-C134S-F TGTGGAGGAATTTGATCATCACTCCCCCTGGGTGAATAAC pcDNA3.1-ZDHHC5-C134S-3Flag/co-IP
ZDHHC5-C134S-R GTTATTCACCCAGGGGGAGTGATGATCAAATTCCTCCACA
ZDHHC5PDZ-3Flag-R TGCTGGATATCTGCAGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCGGTGGTACCACCAACCCCTG (EcoRI) pcDNA3.1-ZDHHC5PDZ-3Flag/co-IP
ZDHHC5PDZ-R TTATCTAGATCCGGTGGATCCTCAGGTGGTACCACCAACCCCTG (BamHI) pDsRed2-ZDHHC5PDZ/localization
S-F TCAGATCTCGAGCTCAAGCTTATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGCGTGAACCTGACCACA (HindIII) pEGFP-S/localization
S-R CACCATGGTGGCGATGGATCCGGTGTAGTGCAGCTTCACGCC (BamHI)
SC10A-R CACCATGGTGGCGATGGATCCGGTGTAGTGCAGCTTCACGCCCTTCAGCACTGGCTCGGAATCGTCCTCATCAAACTTAGCGGCGGAGCCAGCGCTAGCGGCGCCCTTCAGGGCAGAAGCGGCGGATGTCATAGCGGCCAG (BamHI) pEGFP-SC10A/localization
ZDHHC5-F2 TCGAGCTCAAGCTTCGAATTCTATGCCCGCAGAGTCTGGAAAG (EcoRI) pDsRed2-ZDHHC5/localization
ZDHHC5-R2 TTATCTAGATCCGGTGGATCCTCACACCGAAATCTCATAGG (BamHI)
GOLGA7-F2 TCGAGCTCAAGCTTCGAATTCTATGAGGCCGCAGCAGGCGCC (EcoRI) pDsRed2-GOLGA7/colocalization
GOLGA7-R2 TTATCTAGATCCGGTGGATCCTTATCTTCCACTGCTCATGC (BamHI)
ZDHHC5-sgRNA-F CACCGGAACCACGTGAAATCCCGTG lentiCRISPRv2-ZDHHC5 sgRNA/gene editing
ZDHHC5-sgRNA-R AAACCACGGGATTTCACGTGGTTCC
ZDHHC5-F3 TGTATTGGTCGCCGGAACTA PCR
ZDHHC5-R3 CAAGATCACGCCACTGGATG
ZDHHC5-seq-F CACGTATCCTTCAAGGCC Sequencing
GOLGA7-sgRNA-F CACCGGGCGGCCAGTCATATCTCGA lentiCRISPRv2-GOLGA7 sgRNA/gene editing
GOLGA7-sgRNA-R AAACTCGAGATATGACTGGCCGCCC
GOLGA7-F3 CATTGCCTGTTCTGCTTGCA PCR
GOLGA7-R3 CCCTCATGCCCAAAGATGGT
GOLGA7-seq-F GTTTTGGTAACTTAGGCCCAG Sequencing
APT1-F CTTGGTACCGAGCTCGGATCCATGTGCGGCAATAACATGTC (BamHI) pcDNA3.1-APT1-3Flag/co-IP
APT1-3Flag-R TGCTGGATATCTGCAGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCATCAATTGGAGGTAGGAGTT (EcoRI)
APT2-F CTTGGTACCGAGCTCGGATCCATGTGTGGTAACACCATGTC (BamHI) pcDNA3.1-APT2-3Flag/co-IP
APT2-3Flag-R TGCTGGATATCTGCAGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCGACAGGAGGCAGCAGCTTCT (EcoRI)
  1. aSequences of restriction sites are underline