Skip to main content

Table 1 Primers used in the qRT-PCR for the the viral RNA detection of transcriptome samples and validation of the RNA-seq

From: Transcriptional responses of Daphnis nerii larval midgut to oral infection by Daphnis nerii cypovirus-23

No Primer name Primer sequence (5' to 3') Tm (°C) Gene id Target gene
  S1-RTPCR-F GTGCTGATGGTCTGCTAA 49.6 N/A DnCPV S1
  S1-RTPCR-R TGATTGATGACGACATTGAG 51.5   
  S10-RTPCR-F GTCCGCCAATACTCTCAG 52.6 N/A DnCPV S10
  S10-RTPCR-R CGTAGTCCATCGTCAATCA 51.3   
1 CASP8-F ACTGGAGAAGACTATGAGGTTA 51.5 TRINITY_DN10280_c0_g1_i1_3 CASP8
2 CASP8-R ACGCTGTCATCTTGGCTAA 53.7   
3 CYP6AB13-F GATTCACACCAGCATTCAG 51.0 TRINITY_DN11437_c0_g1_i1_6 CYP6AB13
4 CYP6AB13-R CAGTCGTATATCTCGCCATA 50.5   
5 CYP6B45-F GCGATACCGAACCAGAAC 53.4 TRINITY_DN12532_c0_g7_i1_1 CYP6B45
6 CYP6B45-R ATTGGCAGTAAGTGTGAGTT 51.0   
7 DHRS4-F TCTTCTATCGCCGCATATCA 52.8 TRINITY_DN12896_c1_g2_i3_3 DHRS4
8 DHRS4-R CACCACCTCATTAGCAATCG 53.5   
9 PNLIP-F CACCTCGTAGACTTGGAAGA 53.5 TRINITY_DN12381_c0_g2_i1_6 PNLIP
10 PNLIP-R GTTAGCGTTGCCATTGACA 53.2   
11 PRSS1_2_3-F CCTGGAAGATGGCGTGTT 55.4 TRINITY_DN10836_c0_g5_i1_6 PRSS1_2_3
12 PRSS1_2_3-R TCGGCGGTAATTCGGTTAT 53.5   
13 RDH12-F GTCTAATCGTCCGCTATTGAG 52.5 TRINITY_DN14445_c0_g1_i1_3 RDH12
14 RDH12-R CTGTAGGTGAAGATTGCCATT 52.2   
15 SCARB1-F AACACAACAAGAGGCATCAC 53.0 TRINITY_DN14140_c0_g1_i1_6 SCARB1
16 SCARB1-R GTCGTCGGTTCAATATCCATAA 51.7   
17 SLC46A1-F TGGAACGACACGACAAGT 53.7 TRINITY_DN8071_c0_g1_i2_5 SLC46A1
18 SLC46A1-R CAACAGAGTGCGAACAGTATA 51.7   
19 SLC52A3-F AAGCGATTGTGGAAGATGTC 52.5 TRINITY_DN11521_c0_g1_i2_4 SLC52A3
20 SLC52A3-R CGGCATACACGAGTACGA 54.4   
21 ABCA3-F CGATATACGCCGCAAGTAAG 53.3 TRINITY_DN12365_c0_g1_i6_2 ABCA3
22 ABCA3-R GCAGTTCTCTACATTCAGTTGA 51.8   
23 ABCC4-F AGTGGATGGAAGGTTGGAAT 53.3 TRINITY_DN11997_c1_g1_i24_2 ABCC4
24 ABCC4-R CGGCTCTTGTGGTATAATTGA 51.9   
25 CYP6B6-F GGACTATTGTTGGCGAATC 50.7 TRINITY_DN13898_c0_g1_i1_4 CYP6B6
26 CYP6B6-R TTGTGGAAGAAGACGATGT 50.5   
  GAPDH-F TATGTTCGTTGTCGGAGTTA 50.1 TRINITY_DN5984_c0_g1_i2_2 GAPDH
  GAPDH-R TAGCAGTAGTGGCGTGTA 52.4   
27 LYPLA3-F ACATCCACGACACAAGACTA 52.8 TRINITY_DN10250_c0_g1_i1_1 LYPLA3
28 LYPLA3-R GACCGATAATGAACTCCTGAAT 51.5   
29 NTE-F CAGCCTGGAAGGTAAGTAGT 53.6 TRINITY_DN14343_c0_g2_i1_4 NTE
30 NTE-R CTCATAGACGAGCGACAGT 53.8   
31 UGT-F GCATTCATTCAAGTCCATCAG 51.3 TRINITY_DN14215_c0_g5_i7_5 UGT
32 UGT-R GCCTCCATCAATAATCACCAA 52.2   
33 DnRPL13-F GAACTATTGGCATTGCTGTTG 52 TRINITY_DN4717_c0_g1_i2_3 RPL13
34 DnRPL13-R TCCTCCTCATTGGCTTCAC 54.5