Skip to main content

Table 1 List of primers and primer sequences used for ZIKV, WNVKUN and GAPDH RNA detection by qRT-PCR

From: Flavivirus replication kinetics in early-term placental cell lines with different differentiation pathways

Primers Sequence Reference
Zika4481-forward 5′–CTGTGGCATGAACCCAATAG–3′ [11]
Zika4552c-reverse 5′–ATCCCAKAGRGCACCACTCC–3′  
WNVKUN-forward 5′–TCAAGAATAACTTGGCGATCCA–3′ [12]
WNVKUN-reverse 5′–TCACCTAGGACCGCCCTTT–3′  
GAPDH-forward 5′–ACAGTCCATGCCATCACTGCC–3′ [12]
GAPDH-reverse 5′–GCCTGCTTCACCACCTTCTTG–3′