Skip to main content

Table 4 Cleaned sequences of the initial PCR of pan EEHV DNA polymerase, Round 2A using 6710/6712 [13]

From: The first reported cases of elephant endotheliotropic herpesvirus infectious haemorrhagic disease in Malaysia: case report

Accession number and sample name Sequence (length in bp)
OK635292 Adun S TTGAATCCTATTACTGTCTACCGGGCAGTCAACTAGTTCGGGAGCTATTTGCGTTAAGAACGTCCAATCGTTAAATCTGTCGCAAATATATTGGTTGGTAACGGCCAGCAGTTGTCTGCCCTGCGCCGTGACCGATTCAGCTATGGCCAGACAGGGAAACATCCCTTTCGACACACCGGTGAATCCATACACGGCATTGCAAA (203)
OK635293 Vinodh S TCGATTTTGATCTATTACTGTCTACCGGGCAGTCAACTAGTTCGGGAGCTATTTGCGTTAAGAACGTCCAATCGTTAAATCTGTCGCAAATATATTGTTTGGTAACGGCCAGCAGTTGTCTGCCCTGCGCCGTGACCGATTCAGCTATGGCCAGACAGGGAAACATCCCTTTCGACACACCGGTGAATCCATACACGGCATTGCAAA (207)
OK635294 Tuntan S2 CATCGATTTTGATCTATTACTGTCTACCGGGCAGTCAACTAGTTCGGGAGCTATTTGCGTTAAGAACGTCCAATCGTTAAATCTGTCGCAAATATATTGTTTGGTAACGGCCAGCAGTTGTCTGCCCTGCGCCGTGACCGATTCAGCTATGGCCAGACAGGGAAACATCCCTTTCGACACACCGGTGAATCCATACACGGCATTGCAA (208)
OK635295 Vinodh WB2 TCGATTTTGATCTATTACTGTCTACCGGGCAGTCAACTAGTTCGGGAGCTATTTGCGTTAAGAACGTCCAATCGTTAAATCTGTCGCAAATATATTGTTTGGTAACGGCCAGCAGTTGTCTGCCCTGCGCCGTGACCGATTCAGCTATGGCCAGACAGGGAAACATCCCTTTCGACACACCGGTGAATCCATACACGGCATTGCAAG (207)
  1. WB2 Whole blood from second collection, S serum, S2 serum from second collection