Skip to main content

Table 3 Subsequent PCR protocols and primers used

From: The first reported cases of elephant endotheliotropic herpesvirus infectious haemorrhagic disease in Malaysia: case report

Genes/loci Primer sequences (5′-3′) Product length (bp) Accession number
U60(TERex3) LGH6640: AAATGTTCTATTCCGTATAC
LGH6672: CATGTTGTGCAGGCACTCTTC
LGH6671: GTTTGTAGTAAATGCCGGATC
LGH6672: CATGTTGTGCAGGCACTCTTC
Round 1:
6640/6672: 850
Round 2:
6671/6672: 780
JX011056-62
U71(gM) LGH6749: CTATGGGATCCGAACTTTC
LGH6752: CTACATGCCCATGCAGATAGG
LGH6750: CTTTCTAAGGGGGTTTGTTGC
LGH6752: CTACATGCCCATGCAGATAGG
Round 1:
6749/6752: 730
Round 2:
6750/6752: 710
JX011063-71
U77(HEL) LGH6743: GCAAGGTRGAACGTATCGTCG
LGH6742: CACAGMGCGTTGTAGAACC
LGH6743: GCAAGGTRGAACGTATCGTCG
LGH6742: CACAGMGCGTTGTAGAACC
Round 1:
6732/6742: 680
Round 2:
6743/6742: 680
JX011072-79
U48.5(TK) LGH6764: GCACGRTACCACGTACTC
LGH7968: GCGGCAACGAAGTTCACAGGCATYATGG
LGH7968: GCGGCAACGAAGTTCACAGGCATYATGG
LGH7970: TGCMGCYTGAAGGCTGTTTATATACT
Round 1:
6764/7968: 750
Round 2:
7968/7970: 640
MN864103.1
U48(gH-TK) LGH7981: CTRCATTKMCCAAAGTATGGAAGTA
LGH7985: GGTAGGTTCACCTACATGGAACTTC
LGH7982: CRTYTATATCATCAAARACYTCACA
LGH7985: GGTAGGTTCACCTACATGGAACTTC
Round 1:
7981/7985: 1080
Round 2:
7982/7985: 1040
JX011039-46
U51 (vGPCR1) LGH7506: GATTGTGAACGCTGTATGCT
LGH4963B: GACTTTCTTCGTAGCCCTCGTCTT
LGH7506: GATTGTGAACGCTGTATGCT
LGH5200A: CGTGATACGCTTCAAAACATACA
Round 1:
7506/4963B: 910
Round 2:
7506/5200A: 750
JX011047-55
E54(vOX2-1) LGH8471: ATGCTTCAGAGAAAGTACAGGTAC
LGH8472: GTGTTGCCGCCACGATGCTTCTACG
LGH8471: ATGCTTCAGAGAAAGTACAGGTAC
LGH8506: CTA CGC CAC TTG TAA CAG AAT ATC ACG
Round 1:
8471/8472: 910
Round 2:
8471/8506: 890
MF464882-899