Skip to main content

Table 1 Primers used in real-time RT-PCR of 3D gene, one-step RT-PCR and sequencing reaction of 1D gene of FMDV

From: Molecular detection, phylogenetic analysis and genetic diversity of recently isolated foot-and-mouth disease virus serotype A African topotype, Genotype IV

Serotype Primer designation Primer sequence (5'-3') Amplicon size References
All serotypes 3D-F ACTGGGTTTTACAAACCTGTGA 106 bp [20]
3D-R GCGAGTCCTGCCACGGA
3D-Probe TCCTTTGCACGCCGTGGGAC
O O-Egy-F CCTCCTTCAAYTACGGT 283 bp [21]
A A–1C612F TAGCGCCGGCAAAGACTTTGA 814 bp [14]
SAT2 SAT2-Egy-F TGAYCGCAGTACACAYGTYC 666 bp [22]
A,O, and SAT2 EUR–2B52R GACATGTCCTCCTGCATCTGGTTGAT [14]
All serotypes
(pan-FMDV)
FMD-3161-F TCG CVC AGT ACT ACR CAC AGT A 1143 bp [23]
FMD-4303-R TGA CGT CRG AGA AGA AGA ARG G