Skip to main content

Table 1 Primer sequences for a quantitative real‐time polymerase chain reaction

From: High throughput sequencing of whole transcriptome and construct of ceRNA regulatory network in RD cells infected with enterovirus D68

Name Sequence (5′ → 3′)
ARRDC3-F AGCAGCATTTTGTTACTGACT
ARRDC3-R ACTTTTGTGTATGTCCCGTTT
Fos-F CCGGGGATAGCCTCTCTTACT
Fos-R CCAGGTCCGTGCAGAAGTC
EGR1-F AAGAAAAGCCAAGCAAACCAA
EGR1-R AACGGAACAACACTCTGACAC
Jun-F TCCAAGTGCCGAAAAAGGAAG
Jun-R CGAGTTCTGAGCTTTCAAGGT
hsa-miR-411-3p-F UAUGUAACACGGUCCACUAACC
hsa-let-7c-3p-F CUGUACAACCUUCUAGCUUUCC
hsa-miR-30c-1-3p-F CUGGGAGAGGGUUGUUUACUCC
hsa-miR-323a-5p-F AGGUGGUCCGUGGCGCGUUCGC
hsa-miR-320b-F AAAAGCUGGGUUGAGAGGGCAA
hsa-miR-532-3p-F CCUCCCACACCCAAGGCUUGCA
U6-F CTCGCTTCGGCAGCACATATACT
U6-R ACGCTTCACGAATTTGCGTGTC
\(\beta\)-actin-F CATTGCCGACAGGATGCAG
\(\beta\)-actin-R CGGAGTACTTGCGCTCAGGA