Skip to main content

Table 1 Primer sequences for quantitative real-time PCR

From: Development of a method for evaluating the mRNA transcription activity of influenza virus RNA-dependent RNA polymerase through real-time reverse transcription polymerase chain reaction

Target Purpose Prime name Sequences (5’ to 3’)
Segment 1 mRNA Reverse transcription PR8 seg1 mRNA tag CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTAAACTATTCGA
  Realtime PCR mRNAtag CCAGATCGTTCGAGTCGT
   PR8 seg1 mRNA Re GGAGATATGGGCCAGCATTA
Segment 4 mRNA Reverse transcription PR8 seg4 mRNA tag CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCCTCATATTTCT
  Realtime PCR mRNAtag CCAGATCGTTCGAGTCGT
   PR8 seg4 mRNA Re GGGCAATCAGTTTCTGGATGTGTTCT
Segment 5 mRNA Reverse transcription PR8 seg5 mRNA tag CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCTTTAATTGTC
  Realtime PCR mRNAtag CCAGATCGTTCGAGTCGT
   PR8 seg5 mRNA Re CGATCGTGCCTTCCTTTG
Target Purpose Prime name Sequences (5’ to 3’)
Segment 1 mRNA Reverse transcription PR8 seg1 mRNA tag CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTAAACTATTCGA
  Realtime PCR mRNAtag CCAGATCGTTCGAGTCGT
   PR8 seg1 mRNA Re GGAGATATGGGCCAGCATTA
Segment 4 mRNA Reverse transcription PR8 seg4 mRNA tag CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCCTCATATTTCT
  Realtime PCR mRNAtag CCAGATCGTTCGAGTCGT
   PR8 seg4 mRNA Re GGGCAATCAGTTTCTGGATGTGTTCT
Segment 5 mRNA Reverse transcription PR8 seg5 mRNA tag CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCTTTAATTGTC
  Realtime PCR mRNAtag CCAGATCGTTCGAGTCGT
   PR8 seg5 mRNA Re CGATCGTGCCTTCCTTTG