Skip to main content

Table 2 Primers used in this study for the HRM assay and sequencing

From: First molecular characterization of poxviruses in cattle, sheep, and goats in Botswana

Method Primer name Primer sequence Amplicon size Target and references
HRM CaPV-HRM-For TCCTGGCATTTTAAGTAATGGT 100 Capripoxviruses [15]
CaPV-HRM-Rev GTCAGATATAAACCCGGCAAGTG
PPV-HRM-For TCGAAGATCTTGTCCAGGAAG 112 Parapoxviruses [15]
PPV-HRM-Rev CCGAGAAGATCAACGAGGTC
OPV-HRM-For AGGACTAGCCGCGGTAACTTT 56 Orthopoxviruses [15]
OPV-HRM-Rev ACAAGATAGAAGCGATGGATACTT
Sequencing CpGPCR-OL1F TGAAAAATTAATCCATTCTTCTAAACA 617 Capripoxviruses [18]
CpGPCR-OL1R TCATGTATTTTATAACGATAATGCAAA
CpGPCR-OL2F TTAGCGGTATAATCATTCCAAATA 603
CpGPCR-OL2R GCGATGATTATGATGATTATGAAGTG
CpGPCR-OL3F CACAATTATATTTCCAAATAATCCAA 684
CpGPCR-OL3R TGTACATGTGTAATTTTAATGTTCGTA
CpRPO30-OL1F CAGCTGTTTGTTTACATTTGATTTTT 554
CpRPO30-OL1R TCGTATAGAAACAAGCCTTTAATAGA
CpRPO30-OL2F TTTGAACACATTTTATTCCAAAAAG 520
CpRPO30-OL2R AACCTACATGCATAAACAGAAGC
ORFV-B2Lf-For GACCTTCCGCGCTTTAATTT 1210 Parapoxviruses [19]
ORFV-B2Lf-Rev CCCGCCTGCTAAAAGACT