Skip to main content

Table 1 The list of primers were designed by oligo 7 software and used in this study

From: Lineage analysis of human papillomavirus type 39 in cervical samples of Iranian women

Target gene

Name of primer

Sequence of primer (5′–3′)

Nucleotide position

Amplicon size (bp)

References

E6

39-E6-F1

AGTAACCGAAAACGGTCAGGA

39–59

641

 
 

39-E6-R1

TCGTGACATACAAGGTCAACCG

659–680

 

This study

 

39-E6-F2

CAGGACCGAAATCGGTGGAT

55–74

616

 
 

39-E6-R2

ACAAGGTCAACCGGCTGTAT

652–671

  

LCR

39-LCR-F1

ACTATAGGTCCCCGAAAGCG

7077–7096

752

 
 

39-LCR-R1

AGTATAGGTATGTATGCCCAACC

7807–7829

 

This study

 

39-LCR-F2

ACTTCCTCGTCCTCAGCTACTA

7110–7131

704

 
 

39-LCR-R2

GCCCAACCTATTTCGGTTGCAT

77,930–7814