Skip to main content

Table 1 The list of primers were designed by oligo 7 software and used in this study

From: Lineage analysis of human papillomavirus type 39 in cervical samples of Iranian women

Target gene Name of primer Sequence of primer (5′–3′) Nucleotide position Amplicon size (bp) References
E6 39-E6-F1 AGTAACCGAAAACGGTCAGGA 39–59 641  
  39-E6-R1 TCGTGACATACAAGGTCAACCG 659–680   This study
  39-E6-F2 CAGGACCGAAATCGGTGGAT 55–74 616  
  39-E6-R2 ACAAGGTCAACCGGCTGTAT 652–671   
LCR 39-LCR-F1 ACTATAGGTCCCCGAAAGCG 7077–7096 752  
  39-LCR-R1 AGTATAGGTATGTATGCCCAACC 7807–7829   This study
  39-LCR-F2 ACTTCCTCGTCCTCAGCTACTA 7110–7131 704  
  39-LCR-R2 GCCCAACCTATTTCGGTTGCAT 77,930–7814