Skip to main content

Table 1 Polymerase chain reaction (PCR) conditions for the detection of flavivirus

From: Molecular detection and identification of Culex flavivirus in mosquito species from Jeju, Republic of Korea

Flavivirus Target gene Primer name Nucleotide sequence (5′-3′) Product size (bp) PCR protocol (˚C/s) Reference
Denaturation Annealing Extension Cycles
NS5 PanF-NS5-1373F
PanF-NS5-2481R
AACATGATGGGVAARAGAGAG
ATCCACACHCKGTTCCASAC
1108 94/60 52/60 72/60 35 In-house design
FL-F1
FL-R3
FL-R4
GCCATATGGTACATGTGGCTGGGAGC
GTKATTCTTGTGTCCCAWCCGGCTGTGTCATC
GTGATGCGRGTGTCCCAGCCRGCKGTGTCATC
212 94/30 58/30 72/30 30 [14]