Skip to main content

Table 1 Sequences of primers used in this study

From: Reciprocal transactivation of Merkel cell polyomavirus and high-risk human papillomavirus promoter activities and increased expression of their oncoproteins

Name Sequence (5′-3′) Purpose References
HPV16 E6_F47R.Fw GGTATATGACTTTGCTCGTCGGGATTTATGC defective for polyubiquitination [48]
HPV16 E6_F47R.Rv GCATAAATCCCGACGAGCAAAGTCATATACC defective for polyubiquitination [48]
HPV16 E6_C106R.Fw GGTGTATTAACCGTCAAAAGCCACTG p53 binding mutant [47]
HPV16 E6_C106R.Rv CAGTGGCTTTTGACGGTTAATACACC p53 binding mutant [47]
HPV16 E7_AGQ.Fw CCAGAGACAACTGATGCCTACGGTTATCAGCAATTAAATGACAGC pRb binding mutant [49]
HPV16 E7_AGQ.Rv GCTGTCATTTAATTGCTGATAACCGTAGGCATCAGTTGTCTCTGG pRb binding mutant [49]
HPV16 E7_GSE.Fw GTAACCTTTGGTAGCGAGTGTGACTCTACG CxxC mutant [12]
HPV16 E7_GSE.Rv CGTAGAGTCACACTCGCTACCAAAGGTTAC CxxC mutant [12]
sT_R7A.Fw AGTCCTAAATGCGAAAGAAAGAGAGGC PP2A binding mutant [45]
sT_R7A.Rv GCCTCTCTTTCTTTCGCATTTAGGACT PP2A binding mutant [45]
sT/LT_D44N.Fw GCATCACCCTAATAAAGGGGGAAATCC DnaJ binding mutant [45]
sT/LT_D44N.Rv GGATTTCCCCCTTTATTAGGGTGATGC DnaJ binding mutant [45]
sT_L142A.Fw GCAAAAAAACTGTGCGACGTGGGGAGAG PP2A binding mutant [45]
sT_L142A.Rv CTCTCCCCACGTCGCACAGTTTTTTTGC PP2A binding mutant [45]
sT_91AAAAA95.Fw CCTTGGGAAGAATATGGAACTGCAGCGGCTGCTGCGCAAAGTGGATATAATGCTAG Fbxw7 binding mutant [45]
sT_91AAAAA95.Rv CTAGCATTATATCCACTTTGCGCAGCAGCCGCTGCAGTTCCATATTCTTCCCAAGG Fbxw7 binding mutant [45]
LT_W209A.Fw CGTATGGCACCGCGGAGGATCTCTTCTGC hVam6p mutant [44]
LT_W209A.Rv GCAGAAGAGATCCTCCGCGGTGCCATACG hVam6p mutant [44]
LT_E216K.Fw GGATCTCTTCTGCGATAAATCACTTTCCTCCCCTGAG pRb binding mutant [44]
LT_E216K.Rv CTCAGGGGAGGAAAGTGATTTATCGCAGAAGAGATCC pRb binding mutant [44]
HPV16LCR Δ1_Fw GTGTATATGTTTGTATGAGCTCGTATGTGCTTG Truncated HPV16 LCR This study
HPV16LCRΔ1_Rv CAAGCACATACGAGCTCATACAAACATATACAC Truncated HPV16 LCR This study
HPV16LCRΔ2_Fw CACCTACTAATTGAGCTCTGGTTATTCATTG Truncated HPV16 LCR This study
HPV16LCRΔ2_Rv CAATGAATAACCAGAGCTCAATTAGTAGGTG Truncated HPV16 LCR This study
HPV16LCRΔ3_Fw CCTGACCTGCAGAGCTCGCCAACCATTCC Truncated HPV16 LCR This study
HPV16LCRΔ3_Rv GGAATGGTTGGCGAGCTCTGCAGGTCAGG Truncated HPV16 LCR This study
HPV18LCRΔ1_Fw GTCCTGTGTTTGAGCTCGTTGTATGATTGC Truncated HPV18 LCR This study
HPV18LCRΔ1_Rv GCAATCATACAACGAGCTCAAACACAGGAC Truncated HPV18 LCR This study
HPV18LCRΔ2_Fw CCTCCATTTTGAGCTCCAACCGATTTCG Truncated HPV18 LCR This study
HPV18LCRΔ2_Rv CGAAATCGGTTGGAGCTCAAAATGGAGG Truncated HPV18 LCR This study
HPV18LCRΔ3_Fw CCTGTCCAGGTGAGCTCCAACAATTGCTTGC Truncated HPV18 LCR This study
HPV18LCRΔ3_Rv GCAAGCAATTGTTGGAGCTCACCTGGACAGG Truncated HPV18 LCR This study
MCPyV-EΔ1_Fw GTTTATCAGTCGAGCTCCGCCTCTCC Truncated early MCPyV promoter This study
MCPyV-EΔ1_Rv GGAGAGGCGGAGCTCGACTGATAAAC Truncated early MCPyV promoter This study
MCPyV-EΔ2_Fw GGCAGTATCTAAGGGGAGCTCCCAAGGGC Truncated early MCPyV promoter This study
MCPyV-EΔ2_Rv GCCCTTGGGAGCTCCCCTTAGATACTGCC Truncated early MCPyV promoter This study
MCPyV-LΔ1_Fw CAGAGGCCTCGGAGCTCAGGAGCCCCAAGC Truncated late MCPyV promoter This study
MCPyV-LΔ1_Rv GCTTGGGGCTCCTGAGCTCCGAGGCCTCTG Truncated late MCPyV promoter This study
MCPyV-LΔ2_Fw CCTGGAGAGGCGGAGCTCGACTGATAAACAAAAC Truncated late MCPyV promoter This study
MCPyV-LΔ2_Rv GTTTTGTTTATCAGTCGAGCTCCGCCTCTCCAGG Truncated late MCPyV promoter This study