Skip to main content

Table 1 Primers used for SNP typing

From: Relationship between polymorphism of receptor SCARB2 gene and clinical severity of enterovirus-71 associated hand-foot-mouth disease

SNP ID 2nd-PCRP 1st-PCRP Extension of primers Amplified fragment length (bp)
rs1051326 ACGTTGGATGAGTGAGTGACAGTGAGCTAC ACGTTGGATGTATTTCTTCTGGGACAGCCG GAGGAAGGAACTTGTAAAAA 127
rs11547135 ACGTTGGATGAGAGCTGCGCGCACGAACC ACGTTGGATGATCCAACTGCAAGGAGGGAG cccctCGCCGAAGGGTCCCG 125
rs121909118 ACGTTGGATGTGACCAGAGTCCACATTCAC ACGTTGGATGACTTTATACCGAAAGGCAGG TTTCAGTGACTATGAGAGTGTA 129
rs121909119 ACGTTGGATGGAGATATCGGGCCTGAAAAC ACGTTGGATGCAGCAGAAGCTCTTTGTGAC GATTTCATCTTTGTAGCCC 118
rs1465922 ACGTTGGATGAAGGAAACCGAAACCGAGTC ACGTTGGATGTTCGTGCGCGCAGCTCTGG taCCGGTGCACCCGGGG 126
rs1465923 ACGTTGGATGATCCCTAGGTTGCTGCAAAG ACGTTGGATGTCCCAGAAGTCTGGCATCTC atgcGCACAGCAGGGATACTAAGGC 131
rs1470194 ACGTTGGATGGGTTGGTGTAGGTGAATTAG ACGTTGGATGACTGAAGCTTCTACCTCCTG cccacGTTTACTGGGCCAGCCCAGG 136
rs200053119 ACGTTGGATGTCTGCTGTTAGCAACAAGGC ACGTTGGATGGCCTACTTACCAATACAGGA AACAAGGCCTATGTTTTTGAA 126
rs2119733 ACGTTGGATGCAAGTCTGAAACCCAACAGG ACGTTGGATGACCAGTGTGCTCTGGATGTG ACAGGGCAGTTATTAAATC 111
rs2869851 ACGTTGGATGATGCCAGTCACTGTCCTAAG ACGTTGGATGAATACAAGCATGAGCCACCG gttgACATATTTACATGTAGTTAATGC 139
rs3733255 ACGTTGGATGAAACTGTGTGAGCTGTCCTG ACGTTGGATGGGCCAGAATGTTCCTATCAC TGTTGAAAGAAGGAAAAAGACAC 145
rs3733256 ACGTTGGATGGGCCAGAATGTTCCTATCAC ACGTTGGATGAAACTGTGTGAGCTGTCCTG aTGCAAGGAGGTGGAG 145
rs57374265 ACGTTGGATGGTCAGGGTTCATCCATGTTG ACGTTGGATGGTGGTATATCTACACAACGG CATCCATGTTGTAGCATGTAT 105
rs6811781 ACGTTGGATGAGAGAGTCTCACTCTGTCGC ACGTTGGATGTGGCTGAGGCAGGAGAATTG gcttCAACCTCTGCCTCCC 120
rs6812193 ACGTTGGATGACTTGATCATGGACTCCACC ACGTTGGATGTGCAGTGGTTAATAACATGG GGGAAAGCTGGATTTGAA 112
rs6824953 ACGTTGGATGTCCCAATGTACTGGAAGCTC ACGTTGGATGTAAACCACAGTTGAAGATG gggttGGGTGCAGTGACCAAGTCCTTT 137
rs6841815 ACGTTGGATGTGGCTGAGGCAGGAGAATTG ACGTTGGATGAGAGAGTCTCACTCTGTCGC AGTGAGCCGAGATCA 120
rs727502772 ACGTTGGATGTCTGAGTCTGAAAACACCCG ACGTTGGATGAGTGAAACGGGAGACATTAG TCCGTCTCAGGACTTA 119
rs727502781 ACGTTGGATGGGACTACACAGAAATGGTGC ACGTTGGATGGATTTGGAACCTCTTGGCTG gccgTTTCACTTCTCTGATTTGC 149
rs72857048 ACGTTGGATGGGAGGAATCCTGTCTTTTAC ACGTTGGATGTGATCATGCCACTGCATTCC AAGTCTTGCTCTGTTGC 134
rs75285019 ACGTTGGATGTAGAGACTGCAGCTACTAAG ACGTTGGATGGAGAAGACTCTATCCTAGGC tgtTGGAGATCGAAGCTATAAT 106
rs755903502 ACGTTGGATGCTCTCTTCTGTGTTTCAGGG ACGTTGGATGAGGACAGCTCACACAGTTTC gggttTGTTTCAGGGAACAGCGGATG 118
rs7697073 ACGTTGGATGATCTGACTCCAAATCTCACG ACGTTGGATGTAAGGTGTGATCTTTCTGGG TCTAATAAAAATAAAGTTGCTATCAC 124
rs78737354 ACGTTGGATGATGCCTTGCAACTTCTGCTG ACGTTGGATGATGTTCTCTGCAGCAGTCTC acccGGAGCCTCAAGTCACC 118
rs886041074 ACGTTGGATGATGATCTCCCTGAGGAAGTG ACGTTGGATGGGGATGCTGCTGTCTTAATA actgtGACCACTCTATGACAGTC 100
rs886041076 ACGTTGGATGGACAGTTACCTTAACTTTAC ACGTTGGATGCTGAAAAAATAATTCCACTG tggGGAATGGAATGGGAAAAC 105
rs886041078 ACGTTGGATGTTTCTTGCCTCTCCAGAGTG ACGTTGGATGGTAGGGTATGTTGGTGATG AAAGAGACGGCGAGT 117
rs8475 ACGTTGGATGCATTTAACTAGATAATTGGGC ACGTTGGATGCCTGATAATAGGACTAAACC ggggAGATAATTGGGCATGTCTTA 125