Skip to main content

Table 2 Primers information and amplicons Tm values

From: One-step real-time multiplex reverse transcription-polymerase chain reaction assay with melt curve analysis for detection of potato leafroll virus, potato virus S, potato virus X, and potato virus Y

Target Polarity Primer Sequence (5'–3')a Final conc. (µM) Amplicon size (bp) Genome sequenceb Calculated amplicon Tm (°C) Measured ampicon Tmc (°C)
PLRV F AAGAAGGCAATCCCTTCG 0.25 155 LC501445 87.5 87.6 ± 0.3
R ATGTCTCGCTTGAGCCTC
PVS F TCGTBTGGAATTACATGCTMG 0.50 102 AB451180 (PVSO) 81.0 82.2 ± 0.1
R ATCAAATGTGTCAAAWGCGG LC492754 (PVSA) 82.5 83.1 ± 0.3
PVX F TTCGACTTCTTCAATGGAGTC 0.11 189 AB451181 84.5 85.9 ± 0.2
R TCCAGTGATACGACCTCG
PVY F TGAAAATGGAACCTCGCC 0.14 129 AB451181 (PVYO) 79.0 80.5 ± 0.4
R AATGTGCCATGATTTGCC AB331515 (PVYNA-N) 78.0 79.4 ± 0.2
      AB702945 (PVYNTN) 79.0 80.5 ± 0.3
EF1α F TACTCCAAGGCTAGGTATGATG 0.22 74   74.0–75.0  
R TCAGGGTTGTAACCGACC
  1. aWritten according to the International Union of Pure and Applied Chemistry (IUPAC)
  2. bGenBank accessions (lineage for PVS or strain for PVY) of isolates used for the calculation and the measurement of Amplicon Tm values were shown, corresponding to the values in the same line. For potato EF1α, five sequences of mRNA (GenBank accessions DQ2288628, DQ222490, AJ536671, AB061263, and KF537426) were used
  3. cMeasured Tm values were shown, and the values meant “(Average Tm value) ± 2 × (Standard error).”