One-step real-time multiplex reverse transcription-polymerase chain reaction assay with melt curve analysis for detection of potato leafroll virus, potato virus S, potato virus X, and potato virus Y

Table 2 Primers information and amplicons Tm values

Target	Polarity	Primer Sequence (5'–3')^a	Final conc. (µM)	Amplicon size (bp)	Genome sequence^b	Calculated amplicon Tm (°C)	Measured ampicon Tm^c (°C)
PLRV	F	AAGAAGGCAATCCCTTCG	0.25	155	LC501445	87.5	87.6 ± 0.3
PLRV	R	ATGTCTCGCTTGAGCCTC	0.25	155	LC501445	87.5	87.6 ± 0.3
PVS	F	TCGTBTGGAATTACATGCTMG	0.50	102	AB451180 (PVS^O)	81.0	82.2 ± 0.1
PVS	R	ATCAAATGTGTCAAAWGCGG	0.50	102	LC492754 (PVS^A)	82.5	83.1 ± 0.3
PVX	F	TTCGACTTCTTCAATGGAGTC	0.11	189	AB451181	84.5	85.9 ± 0.2
PVX	R	TCCAGTGATACGACCTCG	0.11	189	AB451181	84.5	85.9 ± 0.2
PVY	F	TGAAAATGGAACCTCGCC	0.14	129	AB451181 (PVY^O)	79.0	80.5 ± 0.4
PVY	R	AATGTGCCATGATTTGCC	0.14	129	AB331515 (PVY^NA-N)	78.0	79.4 ± 0.2
					AB702945 (PVY^NTN)	79.0	80.5 ± 0.3
EF1α	F	TACTCCAAGGCTAGGTATGATG	0.22	74		74.0–75.0
EF1α	R	TCAGGGTTGTAACCGACC	0.22	74		74.0–75.0

^aWritten according to the International Union of Pure and Applied Chemistry (IUPAC)
^bGenBank accessions (lineage for PVS or strain for PVY) of isolates used for the calculation and the measurement of Amplicon Tm values were shown, corresponding to the values in the same line. For potato EF1α, five sequences of mRNA (GenBank accessions DQ2288628, DQ222490, AJ536671, AB061263, and KF537426) were used
^cMeasured Tm values were shown, and the values meant “(Average Tm value) ± 2 × (Standard error).”

ISSN: 1743-422X