Skip to main content

Table 3 Relative quantitative PCR primers

From: In vitro and in vivo analyses of co-infections with peste des petits ruminants and capripox vaccine strains

Gene Primers (5′ → 3′)
TNF-α Forward: GGAATACCTGGACTATGCTGA
Reverse: CCTCACTTCCCTACATCCCT
IFN-α Forward: CAGCCTGGTCCTTACTCCTG
Reverse: CTGCTCTGACAACCTCCCAG
IFN-β Forward: CCAGATGGTTCTCCTGCTGTGT
Reverse: GACCAATACGGCATCTTCCTTC
IL-1β Forward: CCTTGGGTATCAGGGACAA
Reverse: TGCGTATGGCTTTCTTTAGG
IL-10 Forward: GCTGTGCAGAAGTTCATGTT
Reverse: GCTCAGGGAGGCCTCTTCAT
IL-6 Forward: AGAGGCACTGGCAGAAAAC
Reverse: TGCAGGAACTGGATCAGGAC
GAPDH Forward: GGTGATGCTGGTGCTGAGTA
Reverse: TCATAAGTCCCTCCACGATG