Skip to main content

Table 1 sgRNAs used, and their corresponding position within the target open reading frame. Column 1: sgRNA name. Column 2: sgRNA nucleotide position in the orf. Column 3: sgRNA sequence

From: Targeting the Kaposi’s sarcoma-associated herpesvirus genome with the CRISPR-Cas9 platform in latently infected cells

Designation Position within open reading frame Sequence
gfp sgRNA 1 329–348 GCGCCGAGGTGAAGTTCGAG
gfp sgRNA 2 563–582 CCATCGGCGACGGCCCCGTG
orf45 sgRNA 1 184–202 CCCAGACGACGTCTTCGCCG
orf45 sgRNA 2 253–272 GATCAGTCGAGCGGCGAATC
orf73 sgRNA 1 113–132 ACCTACATCTACAACCGCGA
orf73 sgRNA 2 143–162 TCGCCGACTCCGTCGACGGC