Skip to main content

Table 1 The primer sequences used for Caveolin-1 overexpresses vector

From: Caveolin-1 is involved in encephalomyocarditis virus replication in BHK-21 cells

Gene Primer sequence (5′–3′) Size (bp)
Caveolin-1 F:GCTCTAGAATGTCTGGGGGCAAATACGTGGACTC 537
  R:CGGGATCCTCATATCTCTTTCTGCGTGCTGATGC  
  1. Underlined sequences show restriction enzyme sites (XbaI and BamH I) and start codon