Skip to main content

Table 1 The oligonucleotide sequences of primers and TaqMan-LNA probes sequences

From: A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions

Virus type Target gene (NOa) Sequence (5′ → 3′) (forward and reverse primer, probe) Positionsb (position of HHV-6B) Sizec (bp) Fluorophore label
HHV-6 U67(NC_001664d) TAAATATCGATGCCGCTCTG 102,708–102,727 (104,006–104,025) 76 6FAM-BHQ-2
  (NC_000898e) TACGTTCTAGCCATCTTCTTTG 102,762–102,783 (104,060–104,081)   
   CGCAAACGACAAAGCCA 102,735–102,751 (104,033–104,049)   
HHV-7 U36(NC_001716) TTAGACATCTTACACGACAGC 55,407–55,427 147 JOE-BHQ-2
   CAGCTTTTCGAACTTGTCAC 55,534–55,553   
   TTCATCGGGTACGTCCA 55,513–55,529   
HHV-8 ORF65(AF148805) GCGACATATTTCCCTGATCC 112,438–112,457 108 Cy5-BHQ-2
   CCAACTTTAAGGTGAGAGACC 112,525–112,545   
   CATGCGAGCCACCAGG 112,466–112,481   
  1. bp base pair
  2. aNCBI Genbank accession number
  3. bComplete genome nucleotide positions
  4. cSize of PCR products
  5. dNCBI Genbank accession number of HHV-6A
  6. eNCBI Genbank accession number of HHV-6B