Skip to main content

Table 2 List of primers used for GAPDH PCR, nested PCR, real-time PCR, and multiplex PCR

From: Detection of human papillomavirus genotypes, herpes simplex, varicella zoster and cytomegalovirus in breast cancer patients

Assay Name Sequence (5′ → 3′)
GAPDH GAPDH-F ATGTTCGTCATGGGTGTGAA
(110 bp) GAPDH-R GGTGCTAAGCAGTTGGTGGT
MY09/11 MY09 CGTCC (A/C) A (A/G) (A/G) GGA (A/T) ACTGATC
(450 bp) MY11 GC (A/C) CAGGG (A/T) CTATAA(C/T) AATGG
GP5 + /GP6 +  GP5 +  TTTGTTACTGTGGTAGATACTAC
(150 bp) GP6 +  AAAAATAAACTGTAAATCATATTC
HPV 18 E6 HPV 18 E6-F CTG GGC ACT ATA GAG GCC AGT
(78 bp) HPV 18 E6-R GTG TTT CTC TGC GTC GTT GG
  HPV 18 E6-P [FAM] -TGCAACCGAGCACGACAGGAACGA—[TAMRA]
HPV 16 E7 HPV 16 E7-F GAG GAG GAG GAT GAA ATA GAT GGT
(98 bp) HPV 16 E7-R AGC GTA GAG TCA CAC TTG CAA CA
  HPV 16 E7-P [FAM] -CTCTGTCCGGTTCTGCTTGTCCAGCT- [TAMRA]
HSV-1 HSV-1-F GACTCTCCCACCGCCATCAG
(269 bp) HSV-1-R TGTCTTCGGGCGACTGGT
HSV-2 HSV-2-F TATGCCTATCCCCGGTTGGA
(715 bp) HSV-2-R CGTGCCATCCGAATAAACGTG
VZV VZV-F TTGTGTCGGTCTCTCCAAGC
(934 bp) VZV-R TACGTCTTCAACCTCACGCC
CMV CMV-F TGGCTTTTCTTGAACGTGCG
(716 bp) CMV-R CCTTGACGCTGGTTTGGTTG
  1. F forward primer, R reverse primer, P probe, FAM 6-carboxy fluorescein, TAMRA 6-carboxy tetramethyl rhodamine, bp base pair
\