Skip to main content

Table 2 The specifications of the oligos for iPLEX SNP genotyping

From: Association of the host genetic factors, hypercholesterolemia and diabetes with mild influenza in an Iranian population

Name of the Oligo Sequence of Oligo
rs8070740_W1_F ACGTTGGATGGTCATAAGACCCAGATAGGC
rs8070740_W1_R ACGTTGGATGCAGACAAACCTAATGCTGCC
rs8070740_W1_E ATGCTGCCCTGCTA
rs1801274_W1_F ACGTTGGATGCTTCCAGAATGGAAAATCCC
rs1801274_W1_R ACGTTGGATGCTGTGACTGTGGTTTGCTTG
rs1801274_W1_E AGGTGGGATCCAAA
rs1800451_W1_F ACGTTGGATGAGAACAGCCCAACACGTACC
rs1800451_W1_R ACGTTGGATGAGTGATTGCCTGTAGCTCTC
rs1800450_W1_E agAAGATGGGCGTGATG
rs1800451_W1_F ACGTTGGATGAGAACAGCCCAACACGTACC
rs1800451_W1_R ACGTTGGATGAGTGATTGCCTGTAGCTCTC
rs1800451_W1_E TGGTTCCCCCTTTTCT
rs2564978_W1_F ACGTTGGATGGAACAATGTTCACTCCCTAC
rs2564978_W1_R ACGTTGGATGCGTCATCTCCTAGAACACTC
rs2564978_W1_E ACTCCCTACTGTGTTA
rs9856661_W1_F ACGTTGGATGTGCCAGCTTAGAAAACCTCC
rs9856661_W1_R ACGTTGGATGACCCACAGTGAACCTACAGA
rs9856661_W1_E TGCATGGCAGAGGGCT
rs361525_W1_F ACGTTGGATGGGATTTGGTGGGCAAAAGTC
rs361525_W1_R ACGTTGGATGAGATGTCAAACAGGGACTGC
rs361525_W1_E GGACTGCAAATTTCACA
rs3786054_W1_F ACGTTGGATGTATGCAACTCTGGCAGGCAC
rs3786054_W1_R ACGTTGGATGTCTCTTGACCTCGTGATCTG
rs3786054_W1_E aggCCATTCCACACAAGA
rs1800871_W1_F ACGTTGGATGATGCTAGTCAGGTAGTGCTC
rs1800871_W1_R ACGTTGGATGGGTGTACCCTTGTACAGGTG
rs1800871_W1_E CTTGTACAGGTGATGTAA
rs1800872_W1_F ACGTTGGATGTCCTCAAAGTTCCCAAGCAG
rs1800872_W1_R ACGTTGGATGAAAGGAGCCTGGAACACATC
rs1800872_W1_E ccctACTGGCTTCCTACAG
rs1800896_W1_F ACGTTGGATGATTCCATGGAGGCTGGATAG
rs1800896_W1_R ACGTTGGATGGACAACACTACTAAGGCTTC
rs1800896_W1_E tgACCTATCCCTACTTCCCC
rs1800629_W1_F ACGTTGGATGGGAGGCAATAGGTTTTGAGG
rs1800629_W1_R ACGTTGGATGCTGATTTGTGTGTAGGACCC
rs1800629_W1_E cgGGAGGCTGAACCCCGTCC