Skip to main content

Table 1 Primers used for PCR amplification of target genes in this study

From: Characterization of a recombinant pseudorabies virus expressing porcine parvovirus VP2 protein and porcine IL-6

Target gene Primer Sequence a(5′-3′) Primer locationb Restriction site Expected product (bp)
Porcine IL-6 IL6fs GACGAATTCATGAACTCCCTCTCCACA 1–18 EcoR I 639
IL6rs GTCGTTAAC CTACATTATCCGAATG 471–488 Hpa I  
PPV VP2 VP2fs ACCATGGGGGGGGTTGGTG 2739–2758   1635
VP2rs ATCCTATTTCTAGTATAATTT 4359–4373   
PRV gH gH fs GCGTGTACTGCGACTGCGTGTT 62,700–62,721   355
gH rs CGACCTGGCGTTTATTAACCGAGA 63,032–63,055   
PPV NS1 NS1fs CCAAAAATGCAAACCCCAATA 1808–1828   194
NS1rs TCTGGCGGTGTTGGAGTTAAG 1981–2001   
  1. aThe restriction enzyme sites used for the construction are underlined
  2. bThe primers IL6fs/IL6rs were designed to amplify porcine IL-6 gene using plasmid pIRES-IL6 as templates. The primers VP2fs/VP2rs and NS1fs/NS1rs were designed based on the nucleotide sequence (KF429255) of PPV HN genome to amplify VP2 and NS1genes, respectively. The primers gH fs/gH rs were designed to amplify gH gene based on PRV gH nucleotide sequence (KP257591) retrieved from the GenBank