Target gene | Primer | Sequence a(5′-3′) | Primer locationb | Restriction site | Expected product (bp) |
---|
Porcine IL-6 | IL6fs | GACGAATTCATGAACTCCCTCTCCACA | 1–18 | EcoR I | 639 |
IL6rs | GTCGTTAAC CTACATTATCCGAATG | 471–488 | Hpa I | |
PPV VP2 | VP2fs | ACCATGGGGGGGGTTGGTG | 2739–2758 | | 1635 |
VP2rs | ATCCTATTTCTAGTATAATTT | 4359–4373 | | |
PRV gH | gH fs | GCGTGTACTGCGACTGCGTGTT | 62,700–62,721 | | 355 |
gH rs | CGACCTGGCGTTTATTAACCGAGA | 63,032–63,055 | | |
PPV NS1 | NS1fs | CCAAAAATGCAAACCCCAATA | 1808–1828 | | 194 |
NS1rs | TCTGGCGGTGTTGGAGTTAAG | 1981–2001 | | |
- aThe restriction enzyme sites used for the construction are underlined
- bThe primers IL6fs/IL6rs were designed to amplify porcine IL-6 gene using plasmid pIRES-IL6 as templates. The primers VP2fs/VP2rs and NS1fs/NS1rs were designed based on the nucleotide sequence (KF429255) of PPV HN genome to amplify VP2 and NS1genes, respectively. The primers gH fs/gH rs were designed to amplify gH gene based on PRV gH nucleotide sequence (KP257591) retrieved from the GenBank