Skip to main content

Table 1 Description of primers used in this assay, with primer set, pool, concentration, sequences of forward and reverse primers in the set, and location of primer relative to SIVmac239 (Accession: M33262)

From: Validation of multiplex PCR sequencing assay of SIV

Primer Set Pool Concentration (µM) FWD sequence REV sequence Forward primer reference position Reverse primer reference position
1 1 40 TCCTGAGTACGGCTGAGTGAAG CCTTCTTTGTTCTCCAACAGGCT 1115–1137 1475–1498
2 2 30 ATTAG G CTACG ACCCAACG G AA AATTTCCTCCTCTG CCG CTAGA 1363–1385 1711–1733
3 1 20 ACCTAGTGGTG G AAACAGGAACA GTCCTTGTTGTGGAGCTGGTTG 1628–1651 1987–2009
4 2 20 CCATCAAG CG G CTATG CAG ATT GCTGCATCTGTCTGTTCTGCTC 1893–1915 2246–2268
5 1 40 TGGGGTTGCAAAAATGTGTCAGA GCTTTCTTGGTCCCCTCTGTTG 2114–2137 2476–2498
6 2 20 GCCGGGACAGAAGGCTAGATTA TTTAG CAG ATCCACAG CTG GGT 2376–2398 2720–2742
7 1 30 AATTTCCCCATG G CTCAAG TG C TCCTATTCCTCCTACTATTTTTGGGGT 2644–2666 2963–2990
8 2 10 TG G ATACAG GGGCTG ATG ATTCT CCAACTGACCATCCTTTTCCATCTTT 2881–2904 3249–3275
9 1 20 GTCGCCTTAAAGCCAGGAAAGG GAGGTATGGAGAAATATGCATCACCT 3135–3157 3465–3491
10 2 10 TAGG AATACCACACCCTG CAGG CCCTGTCATGTTCCAGGTCTGT 3382–3404 3708–3730
11 1 40 ACATG TG CTAG AACCCTTCAG G A CAG TCCACTG AACTTCCTCTG TT 3602–3625 3996–4019
12 2 10 AGAGAGACCTGGACAGTG AATG A TG TG CTAATAGTCTCACTCCATTG G T 3852–3875 4213–4239
13 1 40 GAGTCAGGACAATCAGTGGTCTTAT ATCCTGCTTTCCCTTCTTTTGACTG 4100–4125 4473–4498
14 2 10 TCTCAACACCACCGCTAGTAAGA TACCTTTGTGTGCTGGTACCCA 4354–4377 4728–4750
15 1 15 CCTACAG AATCAG AGAGCAGGCT ATTTG CCTG CCCATGTATAG CC 4632–4655 4949–4971
16 2 15 CCCAG AATAGTG GCCAGACAGA CAAAG G TG TG CTCTATCCCTG C 4869–4891 5202–5224
17 1 30 ATGGTG CTAACTTTG CTTCG CA GGTCCCTTCCACAGTTGATCTCT 5134–5156 5497–5520
18 2 30 AGGGG ATATG ACTCCAGCAG AA CCATCCG ACCTTAAAATG GGGC 5357–5379 5742–5764
19 1 25 AG AGGTGG ATAG CAGTTCCCAC CTTCTCCCG CTG TAAAG CAAG G 5609–5631 5959–5981
20 2 50 GGACAGATGTAACACCAAACTATGCA TTCCCAAG ACCTTTG CCAAACC 5885–5911 6229–6251
21 1 70 GGAGAAGAGACAATAGGAGAGGCC CATCCCATGGTTCCCTTTGTGG 6107–6131 6458–6480
22 2 10 TCCCCCTCCAG G ACTAG CATAA TG CTTCTAG AGGGCGG TATAG C 6385–6407 6704–6726
23 1 30 TCATG CATTTCAG AGGCGG ATG GCATTCCTCCAAGCTGGTACAC 6615–6637 6972–6994
24 2 10 TTGGG AATCAG CTG CTTATCG C TGTCAATCCCCATCTATCTGTCTCA 6870–6892 7231–7256
25 1 25 AG TCACAG AACAGG CAATAG AGGA TCCCTTGTTCACATACCAAATCTGC 7102–7126 7451–7476
26 2 40 AG CTGTAAATTCAACATGACAG GGTT GTCCTATTATCCCTACCATGCCAGT 7358–7384 7749–7774
27 1 20 GGTGGTCTCTTCATGCACAAGG TGGGATGTTTGACAATGGTCTGC 7633–7655 7955–7978
28 2 20 AAAGCAGGCATGGTGTTGGTTT TGGAGTTACACGTGAGGTCTCC 7876–7898 8243–8265
29 1 20 CCAG AAG CCAAAG GAACAG CAT TTGCGAGAAAACCCAAGAACCC 8113–8135 8471–8493
30 2 20 AG ATG TG AAG AG GTACACTACTG G T CTAAACGCACATCCCCAAGCAT 8389–8414 8700–8722
31 1 15 TAG G GTCACTG CCATCG AG AAG TCCAAGAAGCAAGGTCAAACCA 8632–8654 8921–8943
32 2 40 AGCTGGG ATG TGTTTGG CAATT GCCAAGTCAAGAGGCGTATCAG 8879–8901 9206–9228
33 1 100 GGCAAAGAAAGAGACGGTGGAG AAGAGAGTGAGCTCAAGCCCTT 9101–9123 9495–9517
34 2 40 CTGGAGATCTGCG ACAG AGACT GTAATAAATCCCTTCCAGTCCCCC 9370–9392 9734–9758
35 1 40 TTGGTAG G G GTATCAGTG AGGC CCATGCTAGAACCTCTCCCCAA 9621–9643 9971–9993
36 2 40 CAGATGAGGCACAGGAGG ATG A ACATCAAGAAAGTGGGCGTTCC 9880–9902 10,205–10,227
37 1 40 AGGG ACTTTCCACAAG GGG ATG TCGGTTTCCCAAAGCAGAAAGG 10,131–10,153 10,516–10,538
\