Skip to main content

Table 1 Primer sequences used in the experiment

From: Luteolin inhibits respiratory syncytial virus replication by regulating the MiR-155/SOCS1/STAT1 signaling pathway

Gene Forward Reverse
RSV-F TTGGATCTGCAATCGCCA CTTTTGATCTTGTTCACTTCTCCTTCT
hMX1 GTTTCCGAAGTGGACATCGCA CTGCACAGGTTGTTCTCAGC
hOAS1 TGTCCAAGGTGGTAAAGGGTG CCGGCGATTTAACTGATCCTG
hISG15 CGCAGATCACCCAGAAGATCG TTCGTCGCATTTGTCCACCA
hIFN-α GCCTCGCCCTTTGCTTTACT CTGTGGGTCTCAGGGAGATCA
hIFN-β CATTACCTGAAGGCCAAGGA CAATTGTCCAGTCCCAGAGG
hβ-actin CATGTACGTTGCTATCCAGGC CTCCTTAATGTCACGCACGAT
mMX1 GACCATAGGGGTCTTGACCAA AGACTTGTCTTTCTGAAAAGCC
mOAS1b GAGGTCCACAGTTTAAGGAGTCC GGTACGCCCACTGATGAGATT
mISG15 GGTGTCCGTGACTAACTCCAT CTGTACCACTAGCATCACTGTG
mIFN-α4 TACTCAGCAGACCTTGAACCT CAGTCTTGGCAGCAAGTTGAC
mIFN-β ATGAGTGGTGGTTGCAGGC TGACCTTTCAAATGCAGTAGATTCA
mβ-actin GTATCCTGACCCTGAAGTACC TGAAGGTCTCAAACATGATCT
\