Skip to main content

Table 1 Sequences of LAMP primers for the detection of SARS-CoV-2

From: Rapid point-of-care detection of SARS-CoV-2 using reverse transcription loop-mediated isothermal amplification (RT-LAMP)

Target gene Primer Sequence 5′–3′ Source
N GeneN-A-F3 TGGCTACTACCGAAGAGCT Zhang et al. [10]
GeneN-A-B3 TGCAGCATTGTTAGCAGGAT
GeneN-A-FIP TCTGGCCCAGTTCCTAGGTAGTCCAGACGAATTCGTGGTGG
GeneN-A-BIP AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT
GeneN-A-LF GGACTGAGATCTTTCATTTTACCGT
GeneN-A-LB ACTGAGGGAGCCTTGAATACA
ORF8 ORF8-F3 ACTTGTCACGCCTAAACG This study
ORF8-B3 CTACCCAATTTAGGTTCCTGG
OFR8-FIP AGGACACGGGTCATCAACTACAAGCTGCATTTCACCAAGAA
ORF8-BIP AGGAGCTAGAAAATCAGCACCTATGGGTGATTTAGAACCAGC
ORF8-LF TGGTTGATGTTGAGTACATGAC
ORF8-LB AATTGAATTGTGCGTGGATGAG
RNase P POP7 RNaseP-POP7-F3 TTGATGAGCTGGAGCCA Curtis, Morrison et al. [14]
RNaseP-POP7-B3 CACCCTCAATGCAGAGTC
RNaseP-POP7-FIP GTGTGACCCTGAAGACTCGGTTTTAGCCACTGACTCGGATC
RNaseP-POP7-BIP CCTCCGTGATATGGCTCTTCGTTTTTTTCTTACATGGCTCTGGTC
RNaseP-POP7-LF ATGTGGATGGCTGAGTTGTT
RNaseP-POP7-LB CATGCTGAGTACTGGACCTC
  1. The table shows the sequences of the LAMP (loop-mediated isothermal amplification) primers used in this study. The primers for amplification of SARS-CoV-2 gene N and human RNase P POP7 were previously published. Primers for SARS-CoV-2 amplification were specifically designed for this study