Skip to main content

Table 3 Sequences of the Primers used in Real-Time PCR, cDNA synthesis, PCR amplification and sequencing for EV detection

From: Detection and identification of enteroviruses circulating in children with acute gastroenteritis in Pará State, Northern Brazil (2010–2011)

Primer/ Probe Sequencea Gene Locationb
EVReal T(A) c GCGATTGTCACCATWAGCAGYCA 5′-UTR 599–577
EVRealT(S)c GGCCCCTGAATGCGGCTAATCC 5′-UTR 449–470
PanEVProbe (S)c FAM-CCGACTACTTTGGGWGTCCGTGT-MGBNFQ 5′-UTR 537–559
AN32d GTYTGCCA VP1 3009–3002
AN33 d GAYTGCCA VP1 3009–3002
AN34 d CCRTCRTA VP1 3111–3104
AN35 d RCTYTGCCA VP1 3009–3002
222 d CICCIGGIGGIAYRWACAT VP1 1977–1996
224 d GCIATGYTIGGIACICAYRT VP3 2969–2951
292 d MIGCIGYIGARACNGG VP1 2612–2627
AN88 d TACTGGACCACCTGGNGGNAYRWACAT VP1 2977–2951
AN89 d CCAGCACTGACAGCAGYNGARAYNGG VP1 2602–2627
  1. aDegenerate primers: Y = C or T; R = A or G; W = A or T; M = A or C; N = A, C, G or T; I = Inosine;
  2. bThe locations of all primers are relative to the genome of poliovirus type 1, Mahoney strain;
  3. c[17];
  4. d[14, 16]
\