Skip to main content
Fig. 4 | Virology Journal

Fig. 4

From: First detection of African swine fever (ASF) virus genotype X and serogroup 7 in symptomatic pigs in the Democratic Republic of Congo

Fig. 4

Partial nucleotide sequence alignments of the intergenic region between I73R and I329L genes. Sequences of African swine fever virus (ASFV) strains from the South Kivu province, eastern DRC, showing tetrameric repeats of representative genotypes, including a reference sequence of a virus isolated in 1950 in Kenya (Kenya 1950; GenBank accession no. AY261360.1). The indel that results from the insertion of the nucleotide sequence CCTATATACCTATAATCTTATACCCTATAATCT in the ASFV from Kenya is boxed

Back to article page

Virology Journal

ISSN: 1743-422X