Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Identification of the largest non-essential regions of the C-terminal portion in 3A protein of foot-and-mouth disease virus for replication in cell culture

Primer Sequence(5′ → 3′) usage
HN-1F CAAGAAGTGATTGAGCGGGT  
3A76–153F TGGCAAACATAGTGATCATGGGACCCTACGCCGGGCCACT 76–153
3A76–153R AGTGGCCCGGCGTAGGGTCCCATGATCACTATGTTTGCCA 76–153
3A77–153F CAAACATAGTGATCATGCTAGGACCCTACGCCGGGCCACT 77–153
3A77–153R AGTGGCCCGGCGTAGGGTCCTAGCATGATCACTATGTTTG 77–153
3A80–153F TGATCATGCTACGCGAAGCGGGACCCTACGCCGGGCCACT 80–153
3A80–153R AGTGGCCCGGCGTAGGGTCCCGCTTCGCGTAGCATGATCA 80–153
3A76V-153F CAAACATAGTGATCATGGTAGGACCCTACGCCGGGCCACT 76 V-153
3A76V-153R AGTGGCCCGGCGTAGGGTCCTACCATGATCACTATGTTTG 76 V-153
3A76I-153F CAAACATAGTGATCATGATAGGACCCTACGCCGGGCCACT 76I-153
3A76I-153R AGTGGCCCGGCGTAGGGTCCTATCATGATCACTATGTTTG 76I-153
3A-GFP1F AAGCGCGCAAGAGGCGCCAGATGGTGAGCAAGGGCGAGGA GFP
3A-GFP1R TCCTCGCCCTTGCTCACCATCTGGCGCCTCTTGCGCGCTT GFP
3A-GFP2F GCATGGACGAGCTGTACAAGGGACCCTACGCCGGGCCACT GFP
3A-GFP2R AGTGGCCCGGCGTAGGGTCCCTTGTACAGCTCGTCCATGC GFP
HN-4R GTTCCCTTCTTCATTCTCGC  
  1. indicates amino acids deletion. indicates amino acids insertion