Skip to main content

Table 1 Primer and probe sequence information to detect influenza virus type (A/B) and subtype (H1/H3)

From: Characterization of neuraminidase inhibitor-resistant influenza virus isolates from immunocompromised patients in the Republic of Korea

Type/Subtype Primer/probe Sequence (5′–3′) Target (bp)
A Forward AATCCTGTCACCTCTGACTAAGG Matrix
(98)
Reverse CATTYTGGACAAAKCGTCTACG
Probe FAM-TGCAGTCCTCGCTCAC-MGBNFQ
B Forward GAATGCTGTCAATGAATATTGAGGG Nucleoprotein
(77)
Reverse CATTGAGTCATTCATCATCTTGAGTAGAT
Probe VIC-TCCTTTGACATCTGCAT-MGBNFQ
H1 Forward AACAATTCAACAGACACTGTAGACACAGT Hemagglutinin (144)
Reverse GGGCTACCCCTCTTAGTTTRCATAGTTT
Probe FAM- ATGTAACAGTAACACACTCTGT-MGBNFQ
H3 Forward GGAATGGTTTGTCATTGGGAAT Hemagglutinin (95)
Reverse AAGCTCAATAATGAGRTCAGATGCA
Probe VIC-CTTCCATTTGGAGTRATRCA-MGBNFQ
IPC Forward AGATTTGGACCTGCGAGCG GAPDH
(65)
Reverse GAGCGGCTGTCTCCACAAGT
Probe Cy5-TTCTGACCTGAAGGCTCTGCGCG-BHQ
\