Skip to main content

Table 1 Primers used for amplification of PB2 and PB1 gene segments and subsequent cloning into pHW2000 vector

From: A ligation and restriction enzyme independent cloning technique: an alternative to conventional methods for cloning hard-to-clone gene segments in the influenza reverse genetics system

GeneForward Primer (5′ to 3′)Reverse Primer (5′ to 3′)Expected Size (bp)
PB2TCCGAAGTTGGGGGGGAGCGAAAGCAGGTCCCGCCGGGTTATTAGTAGAAACAAGGTCGTTT2370
PB1TCCGAAGTTGGGGGGGAGCGAAAGCAGGCAAACCCGCCGGGTTATTAGTAGAAACAAGGCATTT2370
  1. The forward and reverse primers contain 16 and 13 nucleotides, respectively which are complementary to the pHW2000 (italics), followed by 12 and 13 nucleotides forming conserved UTR (bold) and 2–6 gene specific nucleotides (underlined). The nucleotide sequences (in italics) anneal to the pHW2000 and allow directional cloning of desired gene segment into the pHW2000 vector