Skip to main content

Table 1 List of primers used to amplify the different regions of the HBV genome and their respective thermal profile

From: Complete genome analysis of hepatitis B virus in Qinghai-Tibet plateau: the geographical distribution, genetic diversity, and co-existence of HBsAg and anti-HBs antibodies

HBV region Round Primer Name (Position) Primer Sequence (5′-3′) Thermal Profile
BCP/Precore region First BcpF1(1254–1273) TCCTCTGCCGATCCATACTG 80 °C(3 min); 95 °C (40 s), 63 °C (1 min), 71 °C (2.5 min)/40 cycle; 72 °C(7 min)
BcpR1(2416–2439) TTCCCGAGATTGAGATCTTCTGCG
Second BcpF2(1606–1625) GCATGGAGACCACCGTGAAC 95 °C(5 min); 95 °C (40 s), 50 °C (30 s), 72 °C (1 min)/35 cycle; 72 °C(7 min)
BcpR2(1955–1974) GGAAAGAAGTCAGAAGGCAA
Complete genome (without BCP) First HBV1799FLong(1799–1826) CTGCGCACCAGCACCATGCAACTTTTTC 80 °C (3 min); 95 °C (40 s), 58 °C (1.5 min), 68 °C (4 min)/45 cycle; 72 °C(7 min)
HBV1801RLong(1774–1801) CAGACCAATTTATGCCTACAGCCTCCTA
Second    
1 HBV1847FS (1847–1867) TGTTCATGTCCCACTGTTCAA 95 °C(5 min); 95 °C (40 s), 63 °C (30 s), 72 °C (1 min)/35 cycle; 72 °C(7 min)
HBV2394RS (2394–2408) GGCGAGGGAGTTCTT
2 HBV2298FS (2298–2315) GACCACCAAATGCCCCTAT
HBV2933RS (2933–2954) TCGGGAAAGAATCCCAGAGGAT
3 HBV2821FS (2821–2840) GGTCACCATATTCTTGGGAAC
HBV272RS (272–291) TGAGAGAAGTCCACCACGAGT
4 HBV179FS (179–197) CTAGGACCCCTGCTCGTGTT
HBV704RS (704–725) CGAACCACTGAACAAATGGCACT
5 HBV0599FS(599–619) GTATTCCCATCCCATCATCCTG
HBV1286RS (1286–1305) GCTAGGAGTTCCGCAGTATGG
6 HBV1175FS (1175–1190) GCCAAGTGTTTGCTGA
HBV1788RS(1788–1802) GCCTACAGCCTCCTA
SP6 CGATTTAGGTGACACTATAGAAGAGAGGCT  
T7 CAGTAATACGACTCACTATAGGGAGAAGGCT  
  1. *Numbers within primer names represent the primer positions. An F after the primer position stands for sense primers while R stands for anti-sense primers
  2. **SP6 and T7 are tag sequences attached at the 5′ end of PCR primers used in this study,except four Bcp primers. SP6 and T7 primers were used to sequence PCR fragments