Skip to main content

Table 3 Specific primers for detection

From: Experimental immunization of mice with a recombinant bovine enterovirus vaccine expressing BVDV E0 protein elicits a long-lasting serologic response

Primer name Primer sequence (5′ to 3′) Product size (bp)
BEV-F TTAAAACAGCCTGGGGGTTGTACC 696
BEV-R TTTACACCCCATCCGGTGGGTG
E0-F AGATGGAATGAGATACAGCTTGG 901
E0-R GGAACGACAGTACTCTCGGA