Skip to main content

Table 2 Primers for overlapping PCR

From: Experimental immunization of mice with a recombinant bovine enterovirus vaccine expressing BVDV E0 protein elicits a long-lasting serologic response

Primer name Primer sequence (5′ to 3′) Product size (bp)
P23-F GCAATAGGCGTTATAACATTGGGAACGTCCTCGAGGCACTCTTCCAGGGCGGCCGCTACCCATACGAC 1317
P23-3CF GGCGGCCGCTACCCATACGACGTCCCAGACTACGCTTCTAGAGCACTCTTCCAGGGCCCAGTTTGCTACAAACCCCTC 1270
P3-R CCAGGGCCTCCAAGCCTTCAGTAC  
  1. Note:NotI (GCGGCCGC) and XbaI (TCTAGA) enzyme double restriction sites are italic, bold and underlined