Skip to main content

Table 1 Primers for the construction of full-length cDNA clone of BEV

From: Experimental immunization of mice with a recombinant bovine enterovirus vaccine expressing BVDV E0 protein elicits a long-lasting serologic response

Primer name Primer sequence (5′ to 3′) Product size (bp)
BEV-AF GTAAAACGACGGCCAGTGAATTGGTCGACTAATACGACTCACTATAGGGTTAAAACAGCCTGGGGGTTG 3383
BEV-AR GGGCCCAATGTGGTCAGGGAGGATCGATCGGTGCAGATCTTATCGGTG
BEV-BF GCACCGATCGATCCTCCCTGACCACATTGGGCCCATTTGGAC 2969
BEV-BR GCCTTCAGTACCATAAATGGCATCCTCCATGGATATCGGCCTAGG
BEV-CF CTAAATATTGATCCTAGGCCGATATCCATGGAGGATGCC 1249
BEV-CR CTCGAAATTAACCCTCACTAAAGGGAACGAATTCTTTTTTTTTTTTTTTTTTACACCCCATCCGGTG