Skip to main content

Table 1 Primer pairs used for qRT-PCR

From: Differential expression of human papillomavirus 16-, 18-, 52-, and 58-derived transcripts in cervical intraepithelial neoplasia

TargetDirectionSequenceProduct size (bp)Genome position
GAPDHForwardGAAAGGTGAAGGTCGGAGTC227 
ReverseGAAGATGGTGATGGGATTTC
HPV 16 E6ForwardAGCGACCCAGAAAGTTACCAC260123–143
ReverseGTTGTATTGCTGTTCTAATGTTG 382–360
HPV 16 E6*ForwardAGCGACCCAGAAAGTTACCAC114123–143
ReverseTTAATACACCTCACGTCGC 418–409 + 226–217
HPV 16 E1^4ForwardCCTGCAGCAGCAACGAAGTATC218874–880 + 3358–3372
ReverseTTGGTCGCTGGATAGTCGTC 3479–3460
HPV 16 L1ForwardGTCTCTTTGGCTGCCTAGTG895641–5660
ReverseTGCGTGCAACATATTCATCCG 5729–5709
HPV 18 E6ForwardAACACGGCGACCCTACAAG248125–143
ReverseATGTGTCTCCATACACAGAGTC 372–351
HPV 18 E6*ForwardAACACGGCGACCCTACAAG120125–143
ReverseACCGCAGGCACCTCTGTAAG 426–416 + 233–225
HPV 18 E1^4ForwardGATCCAGAAGTACCAGTGAC194920–929 + 3434–3443
ReverseGAGAAGTGGGTTGACAGGTC 3617–3598
HPV 18 L1ForwardTCCTTCTGTGGCAAGAGTTGT1235657–5677
ReverseCCACCTGCAGGAACCCTAAAA 5779–5759
HPV 52 E6ForwardTTTGAGGATCCAGCAACAC197105–123
ReverseTAGGCACATAATACACACGCC 302–282
HPV 52 E6*ForwardTTTGAGGATCCAGCAACAC128105–123
ReverseGACAAATTATACATCTCTCTTCG 510–502 + 216–224
HPV 52 E1^4ForwardAGGACCCTGAAGTAACGAAG150868–879 + 3345–3352
ReverseCTGGAGTCTGTGACGTCTGG 3482–3463
HPV 52 L1ForwardACTGTGTACCTGCCTCCTGTA725670–5690
ReverseGATGCTTGTGCGAGACACAT 5741–5722
HPV 58 E6ForwardGAAACCACGGACATTGCATG254130–149
ReverseGTGTTTGTTCTAATGTGTCTCC 383–362
HPV 58 E6*ForwardGAAACCACGGACATTGCATG109130–149
ReverseCAAATAATACATCTCAGATCGC 515–510 + 232–223
HPV 58 E1^4ForwardGACCCTGAAGTGATCAAATATC127889–898 + 3358–3372
ReverseGTGTTGTCTCTGGAGTCTGG 3471–3452
HPV 58 L1ForwardCCTCCTGTGCCTGTGTCTAA1045682–5700
ReverseGGATTGCCAACAGCCAAAAGT 5785–5765
  1. Primer information, such as sequence, product size, and genome position of the primer pairs was summarized