Skip to main content

Table 1 Primers used for multiplex PCR of human herpesviruses in the study

From: Co-infections of human herpesviruses (CMV, HHV-6, HHV-7 and EBV) in non-transplant acute leukemia patients undergoing chemotherapy

Viruses (GenBank accession)PrimerPrimer sequence (5′-3′)PositionProduct length (bp)
HSV-1/2
(HSV-1:M10792,
HSV-2: M16321)
HSV-FATCCAGTACGTCTTTGTGGAGCCCAAGHSV-1:3389292
HSV-2:3058
HSV-RTGAGGACAAAGTCCTGGATGTCCCTCTHSV-1:3680
HSV-2:3349
VZV
(X04370)
VZV-FTCCGACATGCAGTCAATTTCAACGTC49651161
VZV-RGGTCGGGTAGACGCTACCACTCGTTT49811
EBV
(NC_007605)
EBV-FCTTAGAATGGTGGCCGGGCTGTAAAAT153240229
EBV-RATCCAGTACGTCTTTGTGGAGCCCAAG153468
CMV
(NC_001347)
CMV-FGCGCGTACCGTTGAAAGAAAAGCATAA80362131
CMV-RTGGGCACTCGGGTCTTCATCTCTTTAC80492
HHV6A/B
(HHV6A: NC_001664,HHV6B: AB021506)
HHV6-FATGCGCCATCATAATGCTCGGATACAHHV-6A: 57837183
HHV-6B: 58791
HHV6-RCCCTGCATTCTTACGGAAGCAAAACGHHV-6A: 58019
HHV-6B: 58973
HHV7
(NC_001716)
HHV7-FGCCCGTTTTCGGAAATATTGGAGAGAT55671347
HHV7-RACGCACGAGACGCACTTTTCTTAAACA56017
  1. Primers and targets used in the Multiplex PCR assay for the simultaneous detection of herpesviruses (HSV-1/2, VZV, EBV, CMV, HHV-6A/B, and HHV-7). Each primer pair was designed with different amplicon size to identify each product with agarose gel electrophoresis