Skip to main content

Table 1 Mutant primer sequences

From: Roles of the highly conserved amino acids in the second receptor binding site of the Newcastle disease virus HN protein

NameSequence (5′-3′) a
Vector1-FPCTATCGTCTTGAGTCCAACCCGGTA
Vector1-RPTACCGGGTTGGACTCAAGACGATAG
Vector2-FPCTGGGTGAGCAAAAACAGGAAGGC
Vector2-RPGCCTTCCTGTTTTTGCTCACCCAG
T167A-FPCGGCACCCGCTACAGGATCAGGTTGCACTC
T167A-RPCTGATCCTGTAGCGGGTGCCGGGATAAAATTC
G171A-FPCTACAGGATCAGCTTGCACTCGGATACCCTC
G171A-RPCGAGTGCAAGCTGATCCTGTAGTGGGTG
C172A-FPGATCAGGTGCTACTCGGATACCCTCATTCGAC
C172A-RPGTATCCGAGTAGCACCTGATCCTGTAGTGGGTG
R174A-FPGTTGCACTGCTATACCCTCATTCGACATG
R174A-RPGAGGGTATAGCAGTGCAACCTGATCCTG
C196A-FPCTGGTGCTAGAGACCATTCACACTCAC
C196A-RPGAATGGTCTCTAGCACCAGAAAATATCAC
D198A-FPGTTGCAGAGCTCATTCACACTCACATCAG
D198A-RPGTGTGAATGAGCTCTGCAACCAGAAAATATC
S202A-FPCATTCACACGCTCATCAGTATTTAGCAC
S202A-RPCTGATGAGCGTGTGAATGGTCTCTGC
R516A-FPCATAACCGCTGTAAGTTCAAGCAGAAC
R516A-RPGAACTTACAGCGGTTATGCGACTGCG
Y526A-FPCAAGGCAGCAGCTACGACATCAACGTG
Y526A-RPGATGTCGTAGCTGCTGCCTTGGTTCTGC
E547A-FPCATTGCAGCTATATCCAATACCCTCTTTG
E547A-RPATTGGATATAGCTGCAATGCTGAGGC
Ch1-FPCCGGGATTATTAGCTATGCCAACGACTGTTGATGGCTGTGTTAGAATACCCTCATTCG
Ch1-RPTGGCATAGCTAATAATCCCGGCCCCGGCATTAACCTTATTTTCGCAGAGGGATAG
Ch2-FPGGTTGCCAGGATATAGGAAAATCATATCATCAGTATTTAG
Ch2-RPTCCTATATCCTGGCAACCTCGAGTAATTAGATTGTGAGTATAACAG
Ch3-FPCGAAACAAAACACTCTCAGCTGGATATACAACATCAACG
Ch3-RPTGAGAGTGTTTTGTTTCGGATGGCCAGTATGCGACTG
Ch4-FPAATCATAAAAGCTTAGACACATTCAGGATCGTC
Ch4-RPTAAGCTTTTATGATTTATTTCTGCAATGCTGAGGCAATAGG
De1-FPTCCCTCTGCGATACCCTCATTCGACATG
De1-RPGAGGGTATCGCAGAGGGATAGAATGATG
De2-FPCTCACAATCATCAGTATTTAGCACTTGG
De2-RPTACTGATGATTGTGAGTATAACAGTAGTGGG
De3-FPGTCGCATAACATCAACGTGTTTTAAAG
De3-RPCGTTGATGTTATGCGACTGCGGGATATG
De4-FPGCATTGCAAGGATCGTCCCTTTACT
De4-RPGACGATCCTTGCAATGCTGAGGCAATAG
  1. The 10 amino acids in the second receptor binding site were mutated to A by over-lapping PCR. EcoRI-digested pBSK-HN was used as the template to create one PCR fragment with primers mutations-FP (forward primer) and Vector-RP (reverse primer). The same plasmid digested by XbaI was used as the template to generate the other PCR fragment with primers mutations-RP and Vector-FP. Two PCR products at each mutation point with homologous ends were purified and then transformed into DH5α competent cells to obtain the desired mutants. The similar methods were applied in constructing the Ch and De mutants with the primers shown in the above table. In addition, primers Vector1-FP/RP were used in obtaining mutants T167A, G171A, C172A, R174A, C196A, S202A, Ch1, Ch2, De1 and De2. Primers Vector2-FP/RP were used in gaining other mutants
  2. areplacement fragments are underlined in the primer sequences