Skip to main content

Table 1 Primers for BTV1 ten segments and BTV2 segment 2

From: PCR-based reverse genetics strategy for bluetongue virus recovery

PrimerSequence (5′-3′)Amplicon
S1–1-20-FTAATACGACTCACTATAGTTAAAATGCAATGGTCGCABTV1 segment 1
S1–3944-3925-RGTAAGTGTAATGCGGCGCGT
S2–1-20-FTAATACGACTCACTATAGTTAAAATAGTAGCGCGATGBTV1 segment 2
S2–2940-2921-RGTAAGTCTAATAGTGCGCGG
S3–1-20-FTAATACGACTCACTATAGTTAAATTTCCGTAGCCATGBTV1 segment 3
S3–2772-2753-RGTAAGTGTGTTCCCGCTGCC
S4–1-20-FTAATACGACTCACTATAGTTAAAACATGCCTGAGCCABTV1 segment 4
S4–1981–1962-RGTAAGTTGTACATGCCCCCC
S5–1-20-FTAATACGACTCACTATAGTTAAAAAAGTTCTCTAGTTBTV1 segment 5
S5–1772–1753-RGTAAGTTGAAAAGTTCTAGT
S6–1-20-FTAATACGACTCACTATAGTTAAAAAGTGCGCCCTTAGBTV1 segment 6
S6–1635–1616-RGTAAGTGTAAGTGCTTCCCG
S7–1-20-FTAATACGACTCACTATAGTTAAAAATCTATAGAGATGBTV1 segment 7
S7–1156–1137-RGTAAGTGTAATCTAAGAGAC
S8–1-20-FTAATACGACTCACTATAGTTAAAAAATCCTTGAGTCABTV1 segment 8
S8–1125–1106-RGTAAGTGTAAAATCCCCCCC
S9–1-20-FTAATACGACTCACTATAGTTAAAAAATCGCATATGTCBTV1 segment 9
S9–1049–1030-RGTAAGTGTAAAATCGCCCTA
S10–1-20-FTAATACGACTCACTATAGTTAAAAAGTGTCGCTGCCABTV1 segment 10
S10–822-803GTAAGTGTGTAGCGCCGCAT
rS2–1-20-FTAATACGACTCACTATAGTTAAAACAGGATCGCGATGBTV2 segment 2
rS2–2943-2924-RGTAAGTTGAACAGATCGCGG