Skip to main content

Table 1 Swine-specific primer sequences used for quantitative SYBR ROX-1 real-time PCR

From: Endothelial IL-8 induced by porcine circovirus type 2 affects dendritic cell maturation and antigen-presenting function

Gene source/accession no.Accession numberPrimer sequence (5′-3′)Annealing temperature
(°C)
Products
(bp)
LMP7AF059493For: AGTGATTGTGGCGGTGGATT56328
Rev: CCGAGTCCCATTTTCATCCA
UBPAF134195For: GTGAGAACTGTGGCAGGAAGACC58347
Rev: TTCCCAGGACACCCAACAGA
MHC-IAY135587For: GAGGGGCAGGAGTATTGGGATAG58309
Rev: CCTCAATTGCTCCGCCACAT
CalreticulinGQ984146For: ATGACTGCTAGGTGTTTAAAATTA56226
Rev: GGATCTCTGGCAGGTCAAGT
β-actinU 07786For: TCATCACCATCGGCAACT59547
Rev: TTCCTGATGTCCACGTCGC
  1. Note: β-actin was used as the internal control
  2. bp: base pairs; for: forward primer; rev: reverse primer