Skip to main content

Table 1 Primers for analysis of gene expression by qRT-PCR

From: Downregulation of microRNA-30a-5p contributes to the replication of duck enteritis virus by regulating Beclin-1-mediated autophagy

PrimersSequence
RT-miR-146b-5pGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAACGCCTA
RT-miR-125b-5pGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCACAAGTT
RT-miR-30a-5pGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGCTTCCA
RT-miR-27b-3pGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGCAGAACT
RT-miR-16c-5pGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTCCAGTA
RT-miR-130b-3pGTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACGCCCTT
miR-146b-5p (F)GCCGTGAGAACTGAATTCCATA
miR-125b-5p (F)GCCGTCCCTGAGACCCTAA
miR-30a-5p (F)GCCGTGTAAACATCCTTGACTG
miR-27b-3p (F)GCCGTTCACAGTGGCTAAG
miR-16c-5p (F)GCCGTAGCAGCACGTAAATA
miR-130b-3p (F)GCCGCAGTGCAATAATGAAA
UR-primerCAGTGCGTGTCGTGGAGT
U6 (F)CTCGCTTCGGCAGCACA
U6 (R)GCGTGTCATCCTTGCGC
Beclin-1 (F)AAGAGGTGCCTGGAGATCCT
Beclin-1 (R)CGTCCTCCAGCTCCTGAATC
β-Actin (F)CCGGGCATCGCTGACA
β-Actin (R)GGATTCATCATACTCCTGCTTTGCT
\