Skip to main content

Advertisement

Table 1 Primers used in this study

From: A novel avian isolate of hepatitis E virus from Pakistan

FragmentPrimer IDSequence (5′-3′)GC%Nucleotide PositionaFragment size (bp)Reference
MeTaHCGFGCATGACCCCATGCCAGGGTAAG611–23849This study
F1RCGGCATGGGGCAGGGCTGGGT76849–829
HelRPHFTGGCGCACYGTWTCYCACCG602791–2810186[16]
RPHRCCTCRTGGACCGTWATCGACCC592956–2977
ORF2RPO2FGGTATGGTTGATTTTGCCATAAAG385433–5456280[16]
RPO2RGCTGCNCGNARCAGTGTCGA555694–5713
ORF2F9FAATGGTAGCTCCGTGGTTTGGTATGC506273–6298385This study
aHCGRACTATGCCCGAGATGGGAGG606658–6639
ORF123 junction & complete
ORF3
APO31SACCATCCAGCTTGTGGCGG634480–4499902This study
APO31ACACAAACCATGAGCATGCCGGACG585382–5359
  1. anucleotide positions using reference sequence AM943646